ID: 1076782433

View in Genome Browser
Species Human (GRCh38)
Location 10:132731639-132731661
Sequence TGAGCCTCCGTTGCATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076782430_1076782433 6 Left 1076782430 10:132731610-132731632 CCAAGGAAGGGCACGCAGGAGGT No data
Right 1076782433 10:132731639-132731661 TGAGCCTCCGTTGCATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076782433 Original CRISPR TGAGCCTCCGTTGCATCTGC TGG Intronic
No off target data available for this crispr