ID: 1076782843

View in Genome Browser
Species Human (GRCh38)
Location 10:132733956-132733978
Sequence GGAGCTCCCAGGAGACTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076782843_1076782850 16 Left 1076782843 10:132733956-132733978 CCTGCGAGTCTCCTGGGAGCTCC 0: 1
1: 0
2: 2
3: 16
4: 183
Right 1076782850 10:132733995-132734017 GTGAGTCAGGCCCAGGGCCCAGG No data
1076782843_1076782847 9 Left 1076782843 10:132733956-132733978 CCTGCGAGTCTCCTGGGAGCTCC 0: 1
1: 0
2: 2
3: 16
4: 183
Right 1076782847 10:132733988-132734010 AGATCCTGTGAGTCAGGCCCAGG No data
1076782843_1076782848 10 Left 1076782843 10:132733956-132733978 CCTGCGAGTCTCCTGGGAGCTCC 0: 1
1: 0
2: 2
3: 16
4: 183
Right 1076782848 10:132733989-132734011 GATCCTGTGAGTCAGGCCCAGGG No data
1076782843_1076782846 3 Left 1076782843 10:132733956-132733978 CCTGCGAGTCTCCTGGGAGCTCC 0: 1
1: 0
2: 2
3: 16
4: 183
Right 1076782846 10:132733982-132734004 GCACACAGATCCTGTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076782843 Original CRISPR GGAGCTCCCAGGAGACTCGC AGG (reversed) Intronic
900093232 1:929676-929698 GCAGATCCCAGGAGACACGCAGG + Intronic
900158629 1:1213247-1213269 GGAGGGCCCAGGAGCCTCGGGGG - Intronic
901208489 1:7510972-7510994 GAAGCTCCCAGGAGCCTCCCTGG - Intronic
901230964 1:7641557-7641579 CGAGCACCCAGGGGACTCTCAGG - Intronic
904488565 1:30844097-30844119 ACTGCTCCCAGGAGACTCCCAGG - Intergenic
905375172 1:37515017-37515039 GGGGCGCACAGGAGACTCGGAGG - Intergenic
906193505 1:43914349-43914371 GGAGCTCTCAGGAGTCTCTCTGG - Intronic
912536436 1:110376382-110376404 GGAGAACCCATGAGACTCCCAGG + Intronic
912733960 1:112133654-112133676 GCACCTCACAGGAGACTGGCTGG + Intergenic
912951110 1:114121115-114121137 TGAGATCCCAGAAGACTCTCTGG - Intronic
914716499 1:150258753-150258775 GGAGCTCCCAGGAGATGAGGAGG + Intronic
918240456 1:182615821-182615843 GCAGCTCCTAGGAGCCTGGCAGG + Intergenic
919705205 1:200669587-200669609 GGAGCTGCTAGGAGACGGGCGGG + Intronic
919730344 1:200909458-200909480 GGAGCTCCCAGGACACAGGTGGG + Intronic
920194554 1:204218207-204218229 GGTGCGCCCGGGAGACTGGCAGG - Intergenic
920438094 1:205961188-205961210 GGAACTCCCAGGAGCTTCTCTGG + Intergenic
1063036495 10:2290973-2290995 GGAGCGCCCTGGAGACGCCCGGG + Intergenic
1067429999 10:46236587-46236609 GGAGACCCCAGGAGCCTGGCAGG - Intergenic
1067828448 10:49596283-49596305 GCAAAGCCCAGGAGACTCGCAGG - Intergenic
1068910855 10:62376589-62376611 GGACCTCCATGCAGACTCGCTGG + Exonic
1069793943 10:71040643-71040665 GGGGATCCCAGGAGACTTGTTGG - Intergenic
1069836679 10:71313653-71313675 TGAGTTCCAAGCAGACTCGCTGG + Intergenic
1069979595 10:72242984-72243006 GCAGCTCCCAGCAGCCTGGCAGG + Intergenic
1071528469 10:86372092-86372114 GGCCCTCCCAGGAGACCTGCTGG + Intergenic
1072987279 10:100151991-100152013 GGAGCACCCAGGACTATCGCAGG + Exonic
1076598545 10:131641613-131641635 GGGGCTCCCACAAGACTCACAGG + Intergenic
1076782843 10:132733956-132733978 GGAGCTCCCAGGAGACTCGCAGG - Intronic
1077108986 11:853858-853880 GAGGCTCCCAGGAGACACCCCGG - Intronic
1078159623 11:8829430-8829452 GGGGCTCCCCGGAGACTGGCGGG - Intronic
1079137948 11:17786914-17786936 TGAGTTCTCAGGAGACTCCCAGG + Intergenic
1079396136 11:20065539-20065561 GGAGTTCCCAGGAGAGCTGCTGG + Intronic
1083765207 11:64838313-64838335 GCAGCTCCTAGGAGACTTGTGGG - Intronic
1083895680 11:65618714-65618736 GGAGCTCTCAGGGGAGTAGCAGG - Exonic
1084285564 11:68128504-68128526 GGAGCTCCCAGGAAAACAGCGGG + Intergenic
1084961294 11:72718127-72718149 GGAGCAGCCAGGAGACTTCCTGG - Intronic
1087166701 11:95012234-95012256 GCAGCTCCCAGAAGCCTGGCTGG + Intergenic
1089453132 11:118610541-118610563 GGCGCTCCCCGGAGCCCCGCGGG - Intronic
1090411898 11:126515048-126515070 GATGCTCCCAGGAGACCCGGTGG + Intronic
1092244397 12:6855487-6855509 GGAGGTGCAAGTAGACTCGCTGG - Exonic
1096625820 12:52895453-52895475 GAAACTCCCAGGAGACTATCTGG + Intergenic
1097929661 12:65169939-65169961 GGCCCTCCCAGGAGGCTCTCTGG - Exonic
1098448350 12:70590796-70590818 GAAGGGCCCAGGAGACTTGCAGG - Intronic
1102261419 12:111445650-111445672 GGAGCTCCCAGGAGACCTGCTGG + Intronic
1103890081 12:124232045-124232067 GGAGGGCCCAGGAGACACGTGGG - Intronic
1103925617 12:124422181-124422203 GGAGCTGGCAGGAGACCCGTCGG + Intronic
1104374474 12:128251696-128251718 TCAGCTCCCAGGAGAGTGGCAGG - Intergenic
1105897181 13:24726328-24726350 GTAGCTCCCAGGAAACGCCCTGG + Intergenic
1108699972 13:52935364-52935386 TGAACTCCCAGGAAACTCTCTGG - Intergenic
1113643637 13:111976392-111976414 GGAGCTCGCTGGGGGCTCGCTGG + Intergenic
1113870064 13:113553857-113553879 AGAGCTTCCAGGTGACTTGCTGG - Intronic
1114283014 14:21212007-21212029 GGAGCTCACAGGAGATACCCAGG + Intronic
1116286989 14:42986509-42986531 GTAGCTTCCCGGAGACTTGCAGG - Intergenic
1116436237 14:44897695-44897717 GGGGCGCCCAGCCGACTCGCGGG + Intronic
1119149639 14:72346754-72346776 GGAGAACCCAGGAGACTGGCTGG - Intronic
1119644408 14:76338093-76338115 GGAGCTTCAAGGCGACTCCCAGG + Intronic
1120341495 14:83226031-83226053 GGAGCTCCCAGGATGGTGGCAGG - Intergenic
1122784439 14:104157342-104157364 GGTGCTCCCAGGAGGCTCAGGGG + Intronic
1122885219 14:104707704-104707726 GGAACTCACAGGAGCCTGGCAGG - Exonic
1122998429 14:105278114-105278136 GGAAGTCTAAGGAGACTCGCAGG - Intronic
1123699476 15:22903752-22903774 TGAGCTCCCAGAAGACGTGCAGG + Exonic
1126800734 15:52295137-52295159 GGAGGGGCCAGGAGACTGGCCGG + Intronic
1127825849 15:62702132-62702154 AGAGCTGCCAGGACCCTCGCTGG + Exonic
1128451288 15:67807234-67807256 GGAGCTAGCAGGAGGCTTGCAGG - Intergenic
1129238337 15:74237067-74237089 AGATCTCCCAGGAGATTCCCAGG + Intronic
1129326369 15:74802203-74802225 GGAGCTCACAGGCCACTCTCCGG + Intronic
1132142251 15:99405714-99405736 GGAGCTCCAGGGAGAATGGCTGG - Intergenic
1132421557 15:101674164-101674186 GCAGCTCCCAAGTGACTAGCAGG - Intronic
1132500337 16:282098-282120 GGATCTCACAGGTAACTCGCAGG + Exonic
1132855714 16:2043786-2043808 GCAGCCCCCAGGAGACCCACAGG + Intronic
1133138755 16:3729740-3729762 AGAGCCCCCAGGAGTCACGCCGG - Exonic
1133337382 16:5014933-5014955 GGAGCTGCTATGAGACTGGCCGG - Exonic
1133900552 16:9969894-9969916 GCAGCTCACAGGAGACTCACAGG + Intronic
1134053791 16:11156520-11156542 ACAGCACCCAGGAGACTCCCAGG - Intronic
1134610672 16:15605741-15605763 GAAGCTCCCAGGAGACCCAGTGG + Intronic
1138029641 16:53550287-53550309 GGAGAAGCCAAGAGACTCGCTGG + Intergenic
1141464481 16:84196874-84196896 GGCCCTACCAGGAGGCTCGCAGG + Exonic
1141710363 16:85695406-85695428 GGAGACCCCAGGAGACAGGCTGG - Intronic
1142135912 16:88452011-88452033 GGAGCTCCCAGCAGGCTGGCGGG + Intergenic
1142293274 16:89202144-89202166 GGAGCTCCCGGGTGACCCGCGGG + Intergenic
1142299465 16:89247874-89247896 GGAGCTCCCGGGTGACCCGCGGG + Intergenic
1143248549 17:5505270-5505292 TGAGCTCCCAGAAGCCTCTCAGG - Intronic
1143314508 17:6022153-6022175 GGAGCTCCCAGGAGAGCCATGGG - Intronic
1143668982 17:8383507-8383529 AGACCGCCCAGGAGACCCGCTGG + Intergenic
1146393679 17:32444761-32444783 GGAGCTCCCCAGAGCCTCCCAGG + Intronic
1147313138 17:39606696-39606718 GGAGCCCGCACGAGACTCGGGGG - Intronic
1147368244 17:39973690-39973712 GGCTCTCCCAGGAGACAGGCAGG + Intronic
1148670796 17:49408642-49408664 GAAGCTCCCAGGAGTCAGGCTGG + Intronic
1150561668 17:66300613-66300635 GGAGTACACAGGAGATTCGCAGG + Intergenic
1151995715 17:77607749-77607771 GGAGGTGCAAGGAGACTCGTAGG + Intergenic
1152057422 17:78040952-78040974 GGAGCTGCCAGGAAGCTCCCGGG - Intronic
1152072790 17:78142275-78142297 GAAGCTCCCAGGTGACTCACCGG + Exonic
1152142108 17:78542668-78542690 GGGGCTCCCAGGAGGCTGGTAGG + Intronic
1152462105 17:80446913-80446935 GTGGCTCCCAGGACACTGGCAGG + Intergenic
1152554302 17:81045446-81045468 GGACCTCCCAGGAGCCTGGCGGG + Intronic
1153705887 18:7745438-7745460 AGAGCTCTCAGAAGACTCACAGG + Intronic
1155303875 18:24459798-24459820 GCAGAGCCCAGGAGACTCCCTGG - Intergenic
1158590107 18:58772031-58772053 GGAGCTCTCCTGAGAATCGCGGG + Intergenic
1160314151 18:77824633-77824655 GTAACTCCCAGGAAACTCCCAGG + Intergenic
1160314154 18:77824644-77824666 GAAACTCCCAGGAAACTCCCAGG + Intergenic
1161495741 19:4584751-4584773 GGAGCCCCCAGGGGATTCCCTGG - Intergenic
1161682438 19:5686960-5686982 GCAGCCCCCAGGCAACTCGCTGG + Exonic
1163424589 19:17234535-17234557 AGAACTCCCAGGAGACAGGCTGG + Intronic
1165284206 19:34825722-34825744 GCAGCTCCCATGATTCTCGCTGG - Intergenic
1165309897 19:35023517-35023539 GGAGCTCCACGGAGGCCCGCAGG - Exonic
1165553096 19:36605267-36605289 TGAGCTCCCAGGAGTCTCCGGGG - Intronic
1166333384 19:42091365-42091387 GGAGAGGCCAGGAGACTTGCTGG + Exonic
1166863431 19:45822587-45822609 GGAGCTCCCAGGCCACCCTCTGG - Intronic
925199726 2:1957789-1957811 GGTGCTCCCTGGAGACTGGGAGG - Intronic
926326131 2:11786176-11786198 GGAGACCCCAGGAGAGTCCCCGG + Intronic
927948749 2:27153280-27153302 GGAGCTACCAGGAGCCTATCCGG - Exonic
931671731 2:64653923-64653945 GGAGCTCGCGGGAGGCTCGCGGG - Intronic
931706210 2:64948296-64948318 GGAGCTCCCAACAAACTCTCAGG + Intergenic
935446871 2:103166510-103166532 GGCCCTCCCAGGAGGCTCCCGGG - Intergenic
939497032 2:142936717-142936739 AGAGCTCCCAGGAAACTTACTGG + Intronic
942220055 2:173760179-173760201 ATCGCTCCCAGGAGACTCTCAGG - Intergenic
945443962 2:209913882-209913904 GGAGCTCCCAGGCAGCTGGCTGG - Exonic
945805721 2:214487739-214487761 GAAGGTCCCAGGAGAATAGCTGG + Intronic
946049452 2:216849852-216849874 GGAGCTCAGAGGACACTCCCAGG - Intergenic
947384779 2:229580132-229580154 AGAGCTCCCAGGAGGCTCAGAGG + Intronic
947984375 2:234436489-234436511 GAAGCTTCCAGGAGACTGGTGGG + Intergenic
948601530 2:239110344-239110366 GCTGGTCCCAGGAGACTTGCAGG - Intronic
948632230 2:239309692-239309714 CCAGCTCCCAGGATACTTGCTGG - Intronic
1171409526 20:24936694-24936716 AGGGCTCCCAGGAGACACACAGG + Intergenic
1172654721 20:36529771-36529793 TGGGCTCCCAGGGGGCTCGCTGG - Intergenic
1173849918 20:46211315-46211337 TGACCTTCCAGGAGACTCACAGG + Intronic
1174114231 20:48215819-48215841 GGAGCTCAGAGGAGACTCCTGGG - Intergenic
1176255597 20:64151071-64151093 GGAGAACTCAGGAGACTAGCTGG + Intergenic
1180178866 21:46108952-46108974 GGAGCTCACAGGAGACCCGCAGG + Intronic
1181033656 22:20159774-20159796 GGAGGTGCCAGGAGCCTCCCGGG + Intergenic
1181509653 22:23383471-23383493 GGAGGTGCCAGGAGCCTCCCGGG - Intergenic
1182457606 22:30461850-30461872 GAAGCTCCCAGCAGACGCACTGG - Intronic
1182584360 22:31335468-31335490 GGAAGTCCCAGGAGACCAGCAGG - Intronic
1184225710 22:43127946-43127968 GGGGCTCCCAGGAGAGGTGCGGG - Intronic
1184924752 22:47629418-47629440 GGAGCTCCCATGGGCCTTGCAGG - Intergenic
1185049002 22:48543966-48543988 GGAGCTCCCAGGGGCCTGGGGGG + Intronic
950045758 3:9947753-9947775 GCAGCTCCCAGGAGAAGCTCAGG + Exonic
950105040 3:10383179-10383201 GGAGCTCCCAGGTGATGTGCAGG + Intronic
952257204 3:31705732-31705754 GGGGCTCCCAGGAGACAAGTAGG - Intronic
953209843 3:40866229-40866251 CAGGCTCCCAGGAGACTCGAAGG - Intergenic
953737402 3:45508213-45508235 GGAGCTCCCATGAGAAGGGCAGG + Intronic
956674877 3:71724795-71724817 TGAGCTCCCAGGCGCCCCGCGGG + Intronic
962867851 3:139462473-139462495 GGAGGTGCCAGGAGACTCCTAGG - Intronic
963750471 3:149173388-149173410 GGAGCACCCAGGAGAATATCTGG + Exonic
964395778 3:156244173-156244195 GAAGCTCCCAGGAGACACTTCGG - Intronic
966340811 3:178923621-178923643 GGAGCTCCCAGGGGAGGGGCAGG + Intergenic
966933126 3:184688573-184688595 GGAGCTGCCAGGAGAGTGGAAGG + Intergenic
969363972 4:6683154-6683176 AGAGCTCCCAGGCCACTGGCAGG + Intergenic
969638604 4:8383535-8383557 GGAGCTGCCAGGAGCCTGGGCGG + Intronic
971044744 4:22792772-22792794 GGAGTTCCCAGGACACAGGCTGG - Intergenic
975421332 4:74167543-74167565 GGAGCTCACAGCAGATTCCCAGG + Intronic
985895464 5:2748263-2748285 GGAGCGCCCGGGAGACCCGAGGG - Intronic
988705366 5:33721236-33721258 CAAGCTCCCAGAAGACTCTCCGG - Intronic
990717065 5:58649170-58649192 GGAGCTCCCAGTGGACCAGCAGG - Intronic
994149501 5:96432207-96432229 GGAGCTCCCTAGAGAGTCGCGGG + Intronic
998649309 5:144100129-144100151 GGAGCTTCCAGGAACCTAGCAGG - Intergenic
1002494005 5:179599595-179599617 GGACCTCCCAGGAAACTCCGAGG + Intronic
1003713803 6:8622941-8622963 GGAGCTCCATGGAGAATGGCAGG + Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1008481753 6:51993269-51993291 AGAGCTCCCAGGAGCCGAGCAGG + Intronic
1014784013 6:125597511-125597533 GCAGCTCCCAGGAGATTAGAAGG + Intergenic
1016620946 6:146108749-146108771 GGAACTCCCTAGAGACTTGCTGG + Intronic
1018582375 6:165318022-165318044 GGACGTCCAAGGAGACTCTCAGG - Intergenic
1019273663 7:164673-164695 GGATCTGAGAGGAGACTCGCTGG - Intergenic
1019487136 7:1294514-1294536 GGAGCTCCCTGGAAACCCACCGG + Intergenic
1021084737 7:16408811-16408833 GGAGGTCGCAGGAGAGTCACTGG + Intronic
1024318094 7:48040134-48040156 GGACCACCCAGGAGACTCCCTGG - Intronic
1027215390 7:76180195-76180217 GGGGCTCCCAGGGGGGTCGCAGG - Intergenic
1028985135 7:97003512-97003534 GGAACTCGGAGGAAACTCGCGGG + Intergenic
1029205139 7:98865284-98865306 GGACCTCACAGGAGACCTGCTGG + Intronic
1029257740 7:99280788-99280810 TAAGCTCCCAGGAGACTCAAGGG + Intergenic
1032085211 7:128880168-128880190 GGAGATCCCTGGAGACTCCTGGG - Intronic
1034949544 7:155287765-155287787 GCAGCTCCCAGGAGACGGGTGGG - Intergenic
1035297409 7:157875251-157875273 GGAGCCCCCAGGAGACTTCCAGG - Intronic
1035429933 7:158811768-158811790 GGACGTCTCAGGAGACTGGCGGG + Intronic
1035685351 8:1519980-1520002 GGAGCTCCCAGCTGCTTCGCAGG + Intronic
1037759494 8:21732568-21732590 GGAGCCCCCATGAGACCAGCAGG + Intronic
1040334054 8:46407193-46407215 GAAGCCCCCAGGAGTGTCGCGGG + Intergenic
1042744366 8:72091075-72091097 GGATCTCCCAAGAAACTCCCAGG + Intronic
1048008719 8:130439841-130439863 GGACCTCCGAGGAGACTTACAGG - Intronic
1048324221 8:133426655-133426677 GGAGCTACCAGGATACTCCAGGG - Intergenic
1048507695 8:135035571-135035593 AGAGCTCCCAGGAGTCAGGCTGG - Intergenic
1049202834 8:141350263-141350285 GGGGCTCCCAGGGGACTGGGAGG - Intergenic
1049275187 8:141716810-141716832 GGAGCTCCCAGCAGCCAGGCTGG - Intergenic
1049290986 8:141801744-141801766 GGAGCTCCCAGCAGACGAGTGGG - Intergenic
1049308411 8:141920314-141920336 AGGGCTCCCAGCAGACTCGTAGG + Intergenic
1049765853 8:144354886-144354908 GGAGCTCACAGGCGACTGACAGG + Exonic
1056790185 9:89620205-89620227 GGAGATCCCAGGGGACTGACAGG - Intergenic
1056936817 9:90921376-90921398 CAAGCTCCCAGGAGACGCCCTGG + Intergenic
1057291665 9:93810792-93810814 CCAGCTCCCAGGAGACAGGCCGG - Intergenic
1057497238 9:95570981-95571003 GGAGCTGCCAGGAGAGTCCCAGG + Intergenic
1057700445 9:97360149-97360171 TGGGCTCCCAGGAGACCTGCAGG + Intronic
1060883771 9:127136423-127136445 GGAGCTCCCAGCAGGGTCCCGGG - Intronic
1061165627 9:128920627-128920649 GGGGCTCCCAGGGGAATGGCTGG + Intergenic
1061425766 9:130497596-130497618 GGAACTCCCAGCAGCCTCGTGGG + Intronic
1061631463 9:131874684-131874706 GTAGCTGCGAGGAGACGCGCTGG + Intronic
1061882167 9:133573977-133573999 GGAGCCCCCAGGTGAGGCGCGGG + Exonic
1062131487 9:134896441-134896463 GTAGCTCCCAGCAGACCCACAGG + Intergenic
1062425568 9:136504620-136504642 GGAGGGCCCAGGAGAGTTGCGGG + Intronic
1062452866 9:136622866-136622888 GGAGCTCCGGGGAGGCTCCCGGG - Intergenic
1189497493 X:41522159-41522181 GGACCTCCCAGCAGCCTCCCAGG - Intronic
1194947911 X:100091117-100091139 GGAGCTCCCAGGGGAGGGGCAGG + Intergenic
1201408513 Y:13673535-13673557 GAAGAGCCCAGGAGACTTGCTGG + Intergenic