ID: 1076783724

View in Genome Browser
Species Human (GRCh38)
Location 10:132738815-132738837
Sequence CAGTGAAAGGCACTGTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076783724_1076783729 5 Left 1076783724 10:132738815-132738837 CCCCATGACAGTGCCTTTCACTG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1076783729 10:132738843-132738865 ATTTCTGCACCCCATAAGCTTGG No data
1076783724_1076783731 13 Left 1076783724 10:132738815-132738837 CCCCATGACAGTGCCTTTCACTG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1076783731 10:132738851-132738873 ACCCCATAAGCTTGGGATGCAGG No data
1076783724_1076783730 6 Left 1076783724 10:132738815-132738837 CCCCATGACAGTGCCTTTCACTG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1076783730 10:132738844-132738866 TTTCTGCACCCCATAAGCTTGGG No data
1076783724_1076783733 14 Left 1076783724 10:132738815-132738837 CCCCATGACAGTGCCTTTCACTG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1076783733 10:132738852-132738874 CCCCATAAGCTTGGGATGCAGGG No data
1076783724_1076783736 26 Left 1076783724 10:132738815-132738837 CCCCATGACAGTGCCTTTCACTG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1076783736 10:132738864-132738886 GGGATGCAGGGCCTTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076783724 Original CRISPR CAGTGAAAGGCACTGTCATG GGG (reversed) Intronic
901210997 1:7525963-7525985 CAGGGTGAGGCACTGGCATGGGG + Intronic
901351557 1:8601461-8601483 CAGTGACACCCACTGTCACGTGG - Intronic
901406555 1:9051335-9051357 CTGTGAAAGACACTGTTAAGAGG + Intronic
901895119 1:12305289-12305311 CAGTGAGAGACCCTGTCTTGAGG - Intronic
902164967 1:14562818-14562840 CTCTGGAAGGCACTGCCATGTGG - Intergenic
904855804 1:33497427-33497449 CAGGGAAAGGCACTGTTGTGTGG + Intergenic
904997349 1:34641336-34641358 CAGAGAAAGACACTCTCATGTGG - Intergenic
907703353 1:56811373-56811395 CAGTGCAAGGGAGTGTCAGGTGG - Intronic
908114071 1:60924247-60924269 CAGTGAAATGGACAGTCTTGGGG + Intronic
911184094 1:94886341-94886363 CAGTGAAAGGAAGTTTCAGGAGG - Intronic
914356910 1:146894391-146894413 AAGTGAAAGGAAGTGTCACGTGG - Intergenic
916337116 1:163685420-163685442 CAGTGAAATGCTCTCTCCTGGGG - Intergenic
917188244 1:172386478-172386500 CAGTGATGGGGACTGACATGAGG - Intronic
917977409 1:180249206-180249228 AAGTGTCAGGCACTGTCCTGAGG - Intronic
918240030 1:182612764-182612786 CACTGAAAATCACTGACATGAGG + Intergenic
918739081 1:188104093-188104115 CAGTAAAAGCCACTCTAATGAGG - Intergenic
921506097 1:215972170-215972192 CAGTGGGAGGCACTGTGAGGAGG + Intronic
922901793 1:229142946-229142968 CACTGAAAAGCACTGGCAAGGGG - Intergenic
923205403 1:231754003-231754025 CAGTGAAAGCCAGGCTCATGAGG - Intronic
924009460 1:239648722-239648744 CAGTGGAAGGGACTGTCACAGGG + Intronic
924046632 1:240038654-240038676 AATTGTAAGGCAATGTCATGAGG + Intronic
924565832 1:245197412-245197434 CAGTGAAAAGCACTTTGAAGAGG + Intronic
924566576 1:245203717-245203739 CAGGGAAAAGCGCTTTCATGCGG - Intronic
924643259 1:245853652-245853674 CAGTAGAAGGTACTGTTATGAGG + Intronic
1062778031 10:171835-171857 CATTGAAAGGCAGTGTGGTGAGG - Intronic
1062941162 10:1422487-1422509 CAGTGAGAGGCAGTGCCCTGTGG + Intronic
1063813294 10:9739815-9739837 TATTGCAAGGCACTGTCTTGTGG - Intergenic
1063985207 10:11494656-11494678 CAGTGATAGGTAAGGTCATGTGG + Intronic
1064846426 10:19659978-19660000 CAGCTAAAGGCACTGTAAAGGGG - Intronic
1065956495 10:30697826-30697848 TATTGAATGACACTGTCATGGGG + Intergenic
1066522374 10:36236491-36236513 CAGGGAAATCCACTGTCATGAGG + Intergenic
1066745479 10:38602062-38602084 CAGTGATAGCTACTGTCAGGAGG + Intergenic
1072634360 10:97168085-97168107 CAGTGACAGCCATTGTTATGTGG - Intronic
1074513308 10:114139227-114139249 CAGGGAAAGGCATTCCCATGTGG - Intronic
1075591959 10:123698385-123698407 CCGTGAGAGCCACTGTGATGTGG - Intergenic
1076783724 10:132738815-132738837 CAGTGAAAGGCACTGTCATGGGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1081131604 11:39387988-39388010 GAGAGAAAGTCAGTGTCATGAGG - Intergenic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1088948875 11:114544751-114544773 CTGTGAAAGACACTGTTAAGAGG + Intronic
1090018460 11:123106296-123106318 CATTGAAAAGCACTGACAAGAGG - Intronic
1090098876 11:123772874-123772896 TACTGAAAGTCACTGTCAAGAGG + Intergenic
1090457342 11:126861462-126861484 CAACGGAAGGCACTGTCAAGGGG - Intronic
1090500442 11:127255662-127255684 CAGGGCAAGTCATTGTCATGTGG + Intergenic
1090774769 11:129954055-129954077 CAGTGAACGGCAATGTAATGGGG - Intronic
1093323980 12:17749981-17750003 CAGGGAAAGGAACTGGCATGTGG + Intergenic
1093850210 12:24027409-24027431 CAGTGAATGGCAATGTCACTTGG - Intergenic
1096932027 12:55221911-55221933 AAGTGAAAGGGGCTGTCAAGAGG + Exonic
1098443782 12:70545720-70545742 CTGTGAAAGGCACTGAGAGGAGG + Intronic
1099802137 12:87470862-87470884 CTGGAAAAGTCACTGTCATGAGG - Intergenic
1100635249 12:96429295-96429317 GAGTGCCAGGCACTGTTATGAGG + Intergenic
1102134708 12:110563880-110563902 CAGTGAAAAGTGCTGACATGAGG + Intronic
1103914877 12:124371043-124371065 GAGTGAGAGGCACAGTCAGGAGG - Intronic
1104164787 12:126217054-126217076 CAGTGAAAGGCAGTCTCCTCTGG - Intergenic
1104483098 12:129125869-129125891 CATTGAAGAGCACTGTGATGTGG + Intronic
1104661650 12:130615820-130615842 CAGTGACAGGCATTTTCCTGTGG + Intronic
1105768127 13:23580378-23580400 TAGTCAAAGAAACTGTCATGGGG - Intronic
1106348273 13:28901324-28901346 CAGTGAAAGACGCTGTCAAGGGG - Intronic
1107652763 13:42561232-42561254 TAGTTAAAGTCACTGTAATGAGG + Intergenic
1108128444 13:47270272-47270294 GAGTGAAACGCATTGTCATTTGG + Intergenic
1109522064 13:63526345-63526367 CAGGGAAAGCCACTGTCATGGGG + Intergenic
1110455157 13:75683178-75683200 CTTTGAAAGGCACTGTTAAGAGG - Intronic
1111481980 13:88841121-88841143 CTATGAAAGGCACTGTTAAGAGG + Intergenic
1112149079 13:96736805-96736827 CAGTGAAAAGCACAGCTATGTGG + Intronic
1112253026 13:97801323-97801345 CAGTGAATGGGACTGACCTGTGG + Intergenic
1112703951 13:102044686-102044708 CTGTAAAAGGCACTTTCAGGAGG + Intronic
1113485989 13:110652680-110652702 CAGTGAGGGGCATTCTCATGTGG + Intronic
1114837657 14:26222648-26222670 CAGCTAAAGGAACTGTCATGGGG + Intergenic
1118110689 14:62715545-62715567 CAGTGAAGGCCACAGTGATGGGG + Intronic
1118131771 14:62973572-62973594 AAGTCCAAGGCACTGGCATGTGG - Intronic
1120603775 14:86545909-86545931 CAGAGAAAGACACGCTCATGAGG + Intergenic
1120764495 14:88316193-88316215 CAGGGGAGGGCACGGTCATGAGG - Intronic
1123014398 14:105366899-105366921 CAGTGCCAGGCACAGTCACGAGG - Intronic
1129118202 15:73378137-73378159 CAGGGACAGGCACTGCGATGGGG + Intergenic
1129902224 15:79159857-79159879 CACTGGAAGGCACTTTCAGGTGG - Intergenic
1130709279 15:86263930-86263952 AAGTGAAAGGCACTGCCTTGGGG + Intronic
1131364254 15:91824497-91824519 CAGTGAAAAGAACTATCTTGTGG + Intergenic
1132518414 16:376562-376584 CACTGAAAGCCACTGTCCCGAGG + Exonic
1132752975 16:1467340-1467362 CAGGGAGAGCCACTGGCATGTGG - Intronic
1135304439 16:21356201-21356223 CAGCGAATGGCACAGCCATGGGG + Intergenic
1135793961 16:25423869-25423891 CACTGAAAAGCACTATAATGTGG - Intergenic
1135959500 16:26983984-26984006 CACTGAAAATCACTGACATGAGG + Intergenic
1136301179 16:29335331-29335353 CAGCGAATGGCACAGCCATGGGG + Intergenic
1137623359 16:49891659-49891681 CAAGGTAGGGCACTGTCATGGGG + Intergenic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1141327681 16:83077730-83077752 CAGTAAAAGGGTATGTCATGGGG + Intronic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141804622 16:86334633-86334655 CAGTGAAGGCCACTGTGAGGAGG + Intergenic
1141857631 16:86694662-86694684 CAGTGGGAGTGACTGTCATGGGG - Intergenic
1142062879 16:88042067-88042089 CAGCGAATGGCACAGCCATGGGG + Intronic
1142843742 17:2655317-2655339 CAGTGAAATGCAATGTGATGTGG - Intronic
1144628552 17:16857927-16857949 CACTGCAAGGCACTGGCCTGTGG + Intergenic
1146795686 17:35779064-35779086 CACTGAAACGCTCTGTCAGGAGG + Exonic
1150519931 17:65855527-65855549 CAATGAAGGGCTCTGTCTTGGGG + Intronic
1150583664 17:66498303-66498325 AAGTGAAAGGCTATGACATGAGG - Intronic
1152291962 17:79445012-79445034 CAGTGAAAGACACAGACATAAGG - Intronic
1154069844 18:11144016-11144038 CAGTGAAGGGCAGAGCCATGAGG + Intronic
1155955236 18:31951345-31951367 CACTGAAAATCACTGACATGAGG - Intronic
1156477273 18:37413706-37413728 AAGTAAAAAGCACTGTCAAGTGG - Intronic
1156972486 18:43172930-43172952 CAGGGAAAGGCAGTGTCCTTTGG + Intergenic
1157126607 18:44962216-44962238 CAGTGAAAGACAAAGTCTTGCGG + Intronic
1157648589 18:49303650-49303672 CTGTGGGAAGCACTGTCATGTGG - Intronic
1159174669 18:64817042-64817064 AATTGAAAGGCTGTGTCATGGGG - Intergenic
1160287140 18:77554238-77554260 CAGTGACAGGCAGTGGGATGTGG - Intergenic
1162248911 19:9426103-9426125 CAATGGAAGGCAGTGTCCTGGGG - Intronic
1164503836 19:28841688-28841710 CAGTGAAACTCACTGTGGTGAGG - Intergenic
1165663958 19:37609526-37609548 CAGTGCAAGACTCTGTCTTGGGG + Intronic
925395288 2:3529141-3529163 CTGTGCAAGACACTGTCCTGGGG + Intergenic
926242849 2:11101426-11101448 CAGAGAAAGTCATTTTCATGGGG + Intergenic
926884125 2:17581697-17581719 GAGAGAAAAGCAGTGTCATGAGG - Intronic
927018927 2:18997548-18997570 GTGTGAAAGGAACTGACATGAGG + Intergenic
929657599 2:43749585-43749607 CTGTCAAAGACATTGTCATGAGG - Intronic
929663710 2:43816451-43816473 CAGTGAAAGGCACAGACAGAAGG + Intronic
929905912 2:46046380-46046402 CATTGAGAAACACTGTCATGTGG - Intronic
933070370 2:77849829-77849851 CAGTGAATGACACTGTCAAAAGG + Intergenic
933646076 2:84813700-84813722 CAGTGCATTGCCCTGTCATGAGG - Intronic
935820775 2:106890369-106890391 CAGTGAAACGAATTTTCATGTGG + Intergenic
939707960 2:145478702-145478724 TAGTGTAAGGCAGAGTCATGAGG - Intergenic
940810027 2:158231860-158231882 CAGTGAATGGAACTGTCCTTAGG - Intronic
941278020 2:163515357-163515379 CAGTGCAAGGCACTGAAAAGAGG + Intergenic
941805592 2:169708865-169708887 CAGCCAAAGGCACTGTTAGGGGG - Intronic
943194800 2:184732013-184732035 CCATGAAAGACACTGTCAAGAGG - Intronic
943304417 2:186241936-186241958 CAGTGAAAATCGCTGACATGAGG - Intergenic
1170898190 20:20435415-20435437 CAGTTAAGGGCACTGTCATTTGG + Intronic
1172068189 20:32236352-32236374 CAGAGCAAGGCCCTGTCTTGGGG - Exonic
1175977825 20:62721565-62721587 CCCTGAATGGCACTTTCATGTGG - Intronic
1176154991 20:63614849-63614871 CAGTGATAGGTAAGGTCATGTGG - Intronic
1177047526 21:16188857-16188879 CAGTGAAAGGCTCTAAGATGGGG - Intergenic
1177260298 21:18721386-18721408 TAGTATAAGGCACAGTCATGTGG + Intergenic
1179241000 21:39592323-39592345 CAGTGAAAGGCCCTGTTAAGAGG + Intronic
1182202916 22:28591979-28592001 GAATGAAAGAGACTGTCATGCGG + Intronic
1185422070 22:50740334-50740356 GAGTGGAAGGCACTGTCATACGG - Intronic
949542921 3:5048146-5048168 CAGTCAAAGGCACCCTCATAGGG - Intergenic
951019826 3:17770444-17770466 CTGTGAAACTCACTGTCATTTGG - Intronic
955273069 3:57520876-57520898 CAGTGAAAGACCCTGTTAAGAGG - Intronic
957529369 3:81421462-81421484 AAGAGAGAGGCAGTGTCATGAGG + Intergenic
958132613 3:89448126-89448148 TAGTGAAAGCCACCGTAATGTGG - Intronic
961803097 3:129467883-129467905 CAATCAAAGGCACTGAGATGGGG - Intronic
962493756 3:135919296-135919318 CAGTGAAGGGCACTATAAAGGGG + Intergenic
963750267 3:149170809-149170831 CAGGGAATGGCACTGACATGTGG + Intronic
964634069 3:158841863-158841885 CACTAAATGGCACTGTCTTGTGG - Intergenic
965184225 3:165442921-165442943 CACTGAAAATCACTGACATGAGG + Intergenic
966218802 3:177530302-177530324 CAGCAAAAAGCAGTGTCATGTGG + Intergenic
966620120 3:181954360-181954382 CAGTGAAAGGCAGTGTGACTGGG - Intergenic
966660792 3:182412149-182412171 CAGAGAAAAGCCCTGACATGTGG - Intergenic
971452595 4:26813898-26813920 CAGTGACAGGCACTGAAGTGGGG - Intergenic
973305316 4:48641635-48641657 AAATGAAAGCTACTGTCATGTGG + Intronic
976883038 4:89953265-89953287 CAGTGAAATACACTGTGATAGGG + Exonic
977389243 4:96386663-96386685 CTTTGAGAAGCACTGTCATGAGG - Intergenic
980446887 4:132921532-132921554 CTGTCAAATGCACTGTGATGAGG + Intergenic
980984024 4:139678160-139678182 CACTGAAAATCACTGACATGAGG - Intronic
982618013 4:157666312-157666334 CAATTAATGGCACTGGCATGGGG - Intergenic
984706490 4:182850914-182850936 CAGGAAAAGCCACTGTCATCAGG + Intergenic
985924883 5:3008059-3008081 CAGTGCAAGGCATTGTTTTGTGG + Intergenic
987889914 5:23863915-23863937 CAGTCAGAGGCTCTGTCAGGGGG - Intergenic
988617022 5:32784817-32784839 CAGTGACAGGAATTGTCGTGGGG + Exonic
989270356 5:39526011-39526033 CAGTGGGAGGCACTGGCGTGGGG - Intergenic
991153670 5:63402529-63402551 GAGTGAAAGCCTCTGTGATGAGG - Intergenic
992073639 5:73171673-73171695 CAGGGAGAGGCATTTTCATGGGG + Intergenic
992631030 5:78680844-78680866 TTGTGAAAGTGACTGTCATGAGG + Intronic
995778927 5:115755436-115755458 CAGTGCAAGGCCCTATCAGGAGG + Intergenic
995969619 5:117952377-117952399 CAGTGACAGGGACTGGCATGAGG + Intergenic
996330792 5:122326518-122326540 CAGTGAAAGATACACTCATGAGG - Intronic
996721624 5:126636091-126636113 CAGTGAAAGGCTTTGCCATGGGG + Exonic
997001254 5:129764792-129764814 CAGAACAAGACACTGTCATGGGG - Intronic
997762260 5:136461258-136461280 CAGTGAAAGGCACTGTGGCCAGG - Intergenic
999611322 5:153372931-153372953 CACTGAATGGCTCTGTCTTGGGG - Intergenic
1000608526 5:163350181-163350203 GAGAGAACTGCACTGTCATGGGG + Intergenic
1001490594 5:172152028-172152050 CAGAGAAAGCCTCTCTCATGAGG - Intronic
1002329212 5:178429933-178429955 CAGGGAAAGGCACGGTCAGTGGG - Intronic
1002437874 5:179243384-179243406 CAGAGAAAGGGACAGTCATAGGG + Intronic
1004018329 6:11752760-11752782 CAATGAGAGGCATTCTCATGAGG - Intronic
1004401217 6:15290633-15290655 CAGCGCAAGGCACTGTCTTGGGG - Intronic
1005560898 6:27039687-27039709 AAGTAGAAGGCACTGTAATGAGG + Intergenic
1005563923 6:27069697-27069719 GAGTAGAAGGCACTGTAATGAGG + Intergenic
1005643775 6:27822029-27822051 CACTGAAAATCACTGTCAAGAGG + Intergenic
1005819418 6:29585290-29585312 CAGTTAAGAGCTCTGTCATGGGG + Intronic
1006034679 6:31202254-31202276 GAGGGAAAGGCACTGGCATGTGG + Intronic
1006073693 6:31515831-31515853 GAGGGAAAGGCACTGGCATGTGG + Intergenic
1006303512 6:33206435-33206457 CAGTGGAAGTCACTGGTATGAGG + Exonic
1009976106 6:70672745-70672767 CTGTGAAAGGGAGTGGCATGTGG + Intronic
1010079402 6:71841558-71841580 CTGTGAAAGACACTGTCAAGAGG - Intergenic
1012864874 6:104606845-104606867 ATGTGCAAGGCACTGTCCTGTGG - Intergenic
1013513663 6:110866369-110866391 CACTGAAAATCACTGTCATGAGG + Intronic
1013705844 6:112833093-112833115 CAGTGAAGGCCACTTTGATGGGG - Intergenic
1014752979 6:125273606-125273628 CAGGGATAGTCACTGTCAAGGGG - Intronic
1019092046 6:169545700-169545722 CTGTGAAAGACCCTGTCAAGAGG + Intronic
1021664937 7:22967815-22967837 CAGTTAATGACACCGTCATGTGG - Intronic
1022554394 7:31277807-31277829 CTGTGAATGGCACATTCATGGGG - Intergenic
1022992916 7:35726017-35726039 TAGGGAAAGACACTGTAATGTGG + Intergenic
1023770085 7:43549132-43549154 AAGTGTATGGCACTGTCAGGAGG - Intronic
1024606064 7:51023635-51023657 CTGTGAAAGGCACTGCCTGGAGG - Intronic
1024769005 7:52696274-52696296 CAGGGAAAGGCATTCTCATTTGG - Intergenic
1028378403 7:90172201-90172223 CAGAGAAAGGCACTCTGAAGAGG - Intronic
1028446600 7:90931541-90931563 CAATGACAGGGACTGTCAGGAGG - Intronic
1028715963 7:93969133-93969155 CAGTGAAGGGCAAAGTCATTGGG - Intronic
1028899865 7:96085182-96085204 AAGAGAAAGGCATGGTCATGGGG - Intronic
1029257109 7:99277176-99277198 CAGTGAAATGCACAGCCTTGGGG - Intergenic
1031361568 7:120855205-120855227 AAGTGAAAGACACTGTCTAGGGG + Intronic
1032469879 7:132170601-132170623 CAGGGCAAGGCACTGGCAGGAGG + Intronic
1034704275 7:153126843-153126865 CACTGAAAGCCACTGTCTAGGGG + Intergenic
1035709737 8:1703561-1703583 GAGTGAAAGGAAATGTAATGTGG + Exonic
1038685777 8:29717097-29717119 CTGTGAAAGACACTGTGAAGAGG + Intergenic
1040823295 8:51589515-51589537 CAGTAAAAGCCATTCTCATGAGG + Intronic
1043521884 8:81055273-81055295 CAGTTAATGGCACTGCCATATGG - Intronic
1044864959 8:96561957-96561979 CTGGGAAAGACACTGTCAAGAGG - Intronic
1045332849 8:101170591-101170613 CAGTGGAAGGCACTGTTAGATGG + Intergenic
1045393496 8:101737809-101737831 CTGAGAAAGGCGCTGGCATGTGG + Intronic
1045525593 8:102938952-102938974 CACTGAAAGTCACTGACAAGAGG - Intronic
1049435450 8:142584191-142584213 CAGGGATAAGCTCTGTCATGGGG + Intergenic
1054793862 9:69280560-69280582 CAGTGCAAGGCACTGGAAGGAGG + Intergenic
1057194829 9:93111129-93111151 CAATGAAAGGGTCCGTCATGGGG - Intronic
1061190253 9:129078682-129078704 CAGTGTAAGCCAGTGTCCTGGGG - Intergenic
1061645327 9:131996301-131996323 CTGAGAAAGGCACAGTGATGAGG + Intronic
1187643630 X:21321856-21321878 CTGTGAAAGACAATGTGATGAGG - Intergenic
1189035221 X:37488622-37488644 CAATGAAATGCAGTGTAATGAGG - Intronic
1189079985 X:37960576-37960598 CAGTAAAAGCCACTCTAATGAGG - Intronic
1190007175 X:46751259-46751281 CAGTGCAAGGGACTGGCAGGTGG - Intronic
1190381707 X:49845506-49845528 CATTCAAAGGGGCTGTCATGGGG + Intergenic
1190829735 X:54048873-54048895 CATTGAAATGCCCTGTCACGGGG - Intronic
1192553316 X:72070606-72070628 CAGTGGAAGGTACTTTCAAGTGG - Intergenic
1193080482 X:77401489-77401511 CAATGAAAGCCATTGTCAAGAGG - Intergenic
1194161081 X:90453441-90453463 CACTGAAAATCACTGACATGAGG - Intergenic
1195041341 X:101017656-101017678 AAGTGAAAGGCACTTGCATTGGG + Intronic
1195589390 X:106606570-106606592 CTGTGAAAGACACTGTTAAGAGG + Intergenic
1195941452 X:110171304-110171326 CAGTAAAAGGAACAGTCATCAGG + Intronic
1199013485 X:142784564-142784586 CAGAGAAAGACTCTGTCTTGAGG - Intergenic
1200507369 Y:4030371-4030393 CACTGAAAATCACTGACATGAGG - Intergenic