ID: 1076786350

View in Genome Browser
Species Human (GRCh38)
Location 10:132751839-132751861
Sequence CGTGGAGGCGGGTGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076786343_1076786350 -8 Left 1076786343 10:132751824-132751846 CCCAGGAAGTGCCTTCGTGGAGG No data
Right 1076786350 10:132751839-132751861 CGTGGAGGCGGGTGCCCAGGAGG No data
1076786337_1076786350 21 Left 1076786337 10:132751795-132751817 CCCAGGAGGTGTCTGGGTGGAGG No data
Right 1076786350 10:132751839-132751861 CGTGGAGGCGGGTGCCCAGGAGG No data
1076786345_1076786350 -9 Left 1076786345 10:132751825-132751847 CCAGGAAGTGCCTTCGTGGAGGC No data
Right 1076786350 10:132751839-132751861 CGTGGAGGCGGGTGCCCAGGAGG No data
1076786339_1076786350 20 Left 1076786339 10:132751796-132751818 CCAGGAGGTGTCTGGGTGGAGGC No data
Right 1076786350 10:132751839-132751861 CGTGGAGGCGGGTGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076786350 Original CRISPR CGTGGAGGCGGGTGCCCAGG AGG Intronic