ID: 1076787621

View in Genome Browser
Species Human (GRCh38)
Location 10:132758871-132758893
Sequence AAACCCGACGCTCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076787621_1076787630 28 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT No data
Right 1076787630 10:132758922-132758944 CCTGAAAAGGATCGGAAAGCTGG No data
1076787621_1076787624 15 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT No data
Right 1076787624 10:132758909-132758931 GACCCGCGTTCCTCCTGAAAAGG No data
1076787621_1076787631 29 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT No data
Right 1076787631 10:132758923-132758945 CTGAAAAGGATCGGAAAGCTGGG No data
1076787621_1076787627 20 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT No data
Right 1076787627 10:132758914-132758936 GCGTTCCTCCTGAAAAGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076787621 Original CRISPR AAACCCGACGCTCAGGAGAC AGG (reversed) Intronic