ID: 1076787621

View in Genome Browser
Species Human (GRCh38)
Location 10:132758871-132758893
Sequence AAACCCGACGCTCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076787621_1076787630 28 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1076787630 10:132758922-132758944 CCTGAAAAGGATCGGAAAGCTGG No data
1076787621_1076787627 20 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1076787627 10:132758914-132758936 GCGTTCCTCCTGAAAAGGATCGG No data
1076787621_1076787624 15 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1076787624 10:132758909-132758931 GACCCGCGTTCCTCCTGAAAAGG No data
1076787621_1076787631 29 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1076787631 10:132758923-132758945 CTGAAAAGGATCGGAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076787621 Original CRISPR AAACCCGACGCTCAGGAGAC AGG (reversed) Intronic
900096832 1:943180-943202 GCACACGACGGTCAGGAGACGGG + Intronic
912866457 1:113262148-113262170 AAACTCTATGCTCAGGAGTCTGG + Intergenic
914830381 1:151166675-151166697 AATCGCGACGCTGAGGAGGCAGG - Intronic
916665394 1:166962425-166962447 ATACCCAACCCTCAGGAGAAGGG - Intronic
920035500 1:203062608-203062630 AAACCCCACCAGCAGGAGACTGG + Intronic
921467699 1:215509779-215509801 AAACCCCATTCTCTGGAGACGGG - Intergenic
921706173 1:218324285-218324307 GAACCCGACGCTCTGGGGGCTGG + Intronic
1073038479 10:100581157-100581179 AAAACCCACCCTCAGGAGATTGG - Intergenic
1075581307 10:123620558-123620580 GAATCTGACACTCAGGAGACAGG + Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1077910754 11:6569907-6569929 GAACCCGAAGCTCAGGAGAGAGG + Intronic
1083316338 11:61816860-61816882 AAACCCGGCGCGCAGGCGGCTGG - Exonic
1083950560 11:65953427-65953449 AAACCCTACTCCCAGGACACTGG + Intronic
1100156085 12:91802046-91802068 ATAGCTGAAGCTCAGGAGACAGG + Intergenic
1101714756 12:107300995-107301017 CAACCCCAAGCTCAGGAGATTGG - Intergenic
1103159779 12:118719457-118719479 AAAACTGAGACTCAGGAGACAGG + Intergenic
1107684850 13:42886572-42886594 AAACCTGACTCGCAGGTGACTGG - Exonic
1110456667 13:75696868-75696890 AAAACCCACTCTCAGGAGAGTGG - Intronic
1110861112 13:80345357-80345379 AAACCAGACCCGCAGGAGCCTGG - Intergenic
1113035205 13:106040475-106040497 AGATCCCACGCTCAGGAGACAGG + Intergenic
1117788589 14:59314149-59314171 AATCCCAACCCTCAGGAGAGTGG - Intronic
1118747374 14:68784168-68784190 AAACCAGACTCTGAGGAGCCAGG - Intergenic
1119744511 14:77034265-77034287 CAACCCGAAACTCAGGAGAGAGG + Intergenic
1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG + Intronic
1127329552 15:57925148-57925170 AAAACAGAAGCTCAGGAGGCAGG - Intergenic
1143756791 17:9073227-9073249 AGTCTCGGCGCTCAGGAGACAGG - Intronic
1144826061 17:18106343-18106365 ACACCCAAAGCTCAGGACACAGG - Intronic
1147717222 17:42516570-42516592 AAACCCAGGGCTCAAGAGACAGG - Intronic
1148656461 17:49287405-49287427 AATCCCGCTACTCAGGAGACTGG - Intergenic
1154123684 18:11671611-11671633 AAACCAGACACCCAGGAGGCAGG - Intergenic
1158679661 18:59555903-59555925 AAACCCACAGCTCAGGAGATTGG + Intronic
1166676505 19:44744616-44744638 AAAGCTAACGATCAGGAGACAGG + Intergenic
929403273 2:41610725-41610747 AAAACTGAAACTCAGGAGACAGG + Intergenic
930278277 2:49339268-49339290 AAAACAGACACTCATGAGACGGG + Intergenic
935182934 2:100706330-100706352 AAACCAGACACTCTGGAGCCGGG + Intergenic
938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG + Intergenic
938447782 2:131391137-131391159 ACACCAGAGGCTCAGGAGCCAGG - Intergenic
945370237 2:209007106-209007128 AAACCCAACACTCAGGAATCTGG + Intergenic
945973526 2:216253257-216253279 AAACCCGGAGTTCAGGAGTCTGG + Intergenic
1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG + Intronic
1180607279 22:17068234-17068256 AAACCTGAAGCCCAGGTGACAGG - Intergenic
960707066 3:120491848-120491870 AAACCCGACAGTCAGGGAACAGG + Intergenic
968466713 4:755312-755334 ACACCCCACACACAGGAGACTGG - Intronic
969215503 4:5719222-5719244 AAACCCGAAGGTCAGGAGTTGGG - Intronic
969854420 4:9987708-9987730 AAACCAGCCTCTCGGGAGACTGG + Intronic
985012938 4:185602348-185602370 AAAGCAGATGCTCAGAAGACTGG + Intronic
985865095 5:2508585-2508607 ATCCCCGACACTCAGGAGCCTGG + Intergenic
990955823 5:61337159-61337181 AATCCCGCCGCTCGGGAGGCTGG + Intronic
995344110 5:111092111-111092133 AAGCGCGACGCCCAGGAGAATGG - Exonic
1008042360 6:46815736-46815758 AAACCCCACGGTCAGGACTCAGG - Intronic
1012627818 6:101425845-101425867 AAAACTGATGCTCAGAAGACAGG - Intronic
1025232145 7:57209843-57209865 CAGCCCGACACTCAGGAGATGGG + Intergenic
1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG + Intergenic
1040299674 8:46181372-46181394 AAGCCCCACGCTTTGGAGACCGG - Intergenic
1041172679 8:55161051-55161073 AAAGCCGAAGCTCAGAACACAGG - Intronic
1047805506 8:128355375-128355397 CATCCTGACCCTCAGGAGACAGG + Intergenic
1047964585 8:130036470-130036492 TAACCCCAAACTCAGGAGACTGG - Intergenic
1049664116 8:143835507-143835529 CAGCCCCACTCTCAGGAGACGGG + Exonic
1051492614 9:17683427-17683449 AAACTCTAGGCTCAGGGGACAGG + Intronic
1051741582 9:20257807-20257829 AAACCAGAGGCTCAGGGGATGGG - Intergenic
1056069626 9:82972751-82972773 AAACCCCAGGTTCAGGAGATAGG + Intergenic
1060101796 9:120847180-120847202 AAACCTGACTCTAAGTAGACAGG - Intergenic
1060252563 9:121997843-121997865 ACAGCCGAGTCTCAGGAGACGGG - Intronic
1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG + Intronic
1062426859 9:136510139-136510161 AGACCCCAAGCACAGGAGACGGG - Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic