ID: 1076787624

View in Genome Browser
Species Human (GRCh38)
Location 10:132758909-132758931
Sequence GACCCGCGTTCCTCCTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076787620_1076787624 16 Left 1076787620 10:132758870-132758892 CCCTGTCTCCTGAGCGTCGGGTT 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1076787624 10:132758909-132758931 GACCCGCGTTCCTCCTGAAAAGG No data
1076787622_1076787624 8 Left 1076787622 10:132758878-132758900 CCTGAGCGTCGGGTTTCGTCAGT 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1076787624 10:132758909-132758931 GACCCGCGTTCCTCCTGAAAAGG No data
1076787621_1076787624 15 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1076787624 10:132758909-132758931 GACCCGCGTTCCTCCTGAAAAGG No data
1076787617_1076787624 23 Left 1076787617 10:132758863-132758885 CCGGCGGCCCTGTCTCCTGAGCG 0: 1
1: 0
2: 0
3: 19
4: 151
Right 1076787624 10:132758909-132758931 GACCCGCGTTCCTCCTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076787624 Original CRISPR GACCCGCGTTCCTCCTGAAA AGG Intronic
No off target data available for this crispr