ID: 1076787630

View in Genome Browser
Species Human (GRCh38)
Location 10:132758922-132758944
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076787621_1076787630 28 Left 1076787621 10:132758871-132758893 CCTGTCTCCTGAGCGTCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1076787630 10:132758922-132758944 CCTGAAAAGGATCGGAAAGCTGG No data
1076787620_1076787630 29 Left 1076787620 10:132758870-132758892 CCCTGTCTCCTGAGCGTCGGGTT 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1076787630 10:132758922-132758944 CCTGAAAAGGATCGGAAAGCTGG No data
1076787622_1076787630 21 Left 1076787622 10:132758878-132758900 CCTGAGCGTCGGGTTTCGTCAGT 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1076787630 10:132758922-132758944 CCTGAAAAGGATCGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr