ID: 1076789754

View in Genome Browser
Species Human (GRCh38)
Location 10:132770563-132770585
Sequence AGCCTCGCTGGCCGCCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076789748_1076789754 -3 Left 1076789748 10:132770543-132770565 CCATCGAAATGGCCCCGCAGAGC No data
Right 1076789754 10:132770563-132770585 AGCCTCGCTGGCCGCCCCGGTGG No data
1076789747_1076789754 0 Left 1076789747 10:132770540-132770562 CCACCATCGAAATGGCCCCGCAG No data
Right 1076789754 10:132770563-132770585 AGCCTCGCTGGCCGCCCCGGTGG No data
1076789746_1076789754 7 Left 1076789746 10:132770533-132770555 CCACATGCCACCATCGAAATGGC No data
Right 1076789754 10:132770563-132770585 AGCCTCGCTGGCCGCCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076789754 Original CRISPR AGCCTCGCTGGCCGCCCCGG TGG Intronic