ID: 1076792514

View in Genome Browser
Species Human (GRCh38)
Location 10:132784857-132784879
Sequence ATCCGGGGGCGGCCCCGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076792514_1076792529 21 Left 1076792514 10:132784857-132784879 CCCACCCGGGGCCGCCCCCGGAT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1076792529 10:132784901-132784923 CCACCCCGCGGGTCCTCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 107
1076792514_1076792524 10 Left 1076792514 10:132784857-132784879 CCCACCCGGGGCCGCCCCCGGAT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1076792524 10:132784890-132784912 TAGATTCGCCCCCACCCCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 33
1076792514_1076792523 9 Left 1076792514 10:132784857-132784879 CCCACCCGGGGCCGCCCCCGGAT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1076792523 10:132784889-132784911 ATAGATTCGCCCCCACCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076792514 Original CRISPR ATCCGGGGGCGGCCCCGGGT GGG (reversed) Exonic
900465111 1:2821704-2821726 ATCCGGGGGCTGCCTCAGGCAGG - Intergenic
901132629 1:6971779-6971801 ACCCGGGGGCGGCCACAGGCAGG - Intronic
905151449 1:35931085-35931107 CTTCCGGGGCGGCCCCGGGCAGG + Exonic
906039431 1:42776547-42776569 ATCGGGGGGCGGCCCGGGGAGGG - Intronic
906140478 1:43531178-43531200 AGCTGGGGGCGGTCCCGGGGGGG + Intronic
906640703 1:47438974-47438996 ATGCGGGGCCGGCCCCGGCGGGG - Exonic
906805645 1:48776838-48776860 CGCCGGGGGCGGGCCCCGGTCGG + Exonic
907430090 1:54406487-54406509 ACGCGGGGGCGGGCCCGGGCCGG + Intronic
909643210 1:77888994-77889016 ACCCTGGGGCAGCCCCTGGTAGG - Intronic
912710095 1:111943928-111943950 ATCAGTGTGCGGCCCCGGCTGGG - Intronic
915194968 1:154182675-154182697 ATCCGGGCGCGGCCGTGGGAGGG - Intronic
915246281 1:154558454-154558476 GGCCGGGGGCGGCCCAGGGGGGG - Exonic
915552246 1:156642035-156642057 GGGCGGGGGCGGCCCCGGGGAGG + Exonic
915596865 1:156901109-156901131 ATCAGTGGGTGGCCCCGGGAGGG - Intronic
917846827 1:179026411-179026433 AGCCTGAGGCGGCCCCAGGTGGG - Intronic
920917894 1:210272837-210272859 TTCAGGAGGCAGCCCCGGGTGGG + Intergenic
924449255 1:244162857-244162879 ATCCGGGGGCCACACCGGCTGGG - Intergenic
1067091316 10:43266960-43266982 GCGCGGGGGCGGCCGCGGGTGGG - Intergenic
1070103896 10:73414061-73414083 AGCCGGGGGCGGGCCCAGGGTGG + Exonic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1074165835 10:110872545-110872567 TTCCGGGGGCCGACCCGGGCTGG + Intronic
1074354967 10:112774389-112774411 ATCCTGGGGTGGCCCCTGGATGG - Intronic
1074591900 10:114821800-114821822 CTCCGGCGGCGGCACCGGTTGGG - Exonic
1076219792 10:128723904-128723926 GTCCGGGGGCTGACCCTGGTAGG - Intergenic
1076792514 10:132784857-132784879 ATCCGGGGGCGGCCCCGGGTGGG - Exonic
1076805784 10:132858272-132858294 TGCTGGGGGCGGCCCCAGGTTGG + Intronic
1077090837 11:777540-777562 GGCCGGGGGCGGAGCCGGGTGGG + Intergenic
1077976511 11:7252741-7252763 AGTTGGGGACGGCCCCGGGTTGG + Intronic
1078338808 11:10484697-10484719 ATGCGGGGCCGGCGCAGGGTTGG + Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083685639 11:64373437-64373459 ATGGGGAGGCGGCCCAGGGTGGG - Intergenic
1087007089 11:93481360-93481382 ACCCGTGGGCGGCCCAGGGACGG + Intronic
1090653229 11:128824638-128824660 CTCCGGGAGCAGCTCCGGGTGGG + Intergenic
1090653253 11:128824693-128824715 CTCAGGGGGCAGCTCCGGGTGGG + Intergenic
1092155303 12:6278541-6278563 TTTCGGGGCCGGCCCCGGCTCGG - Intergenic
1092517706 12:9233010-9233032 ATCGGGGGGGGGACCTGGGTGGG + Intergenic
1096475700 12:51907563-51907585 GTCCGGGCGCGGCCCCGGACCGG - Exonic
1097264172 12:57736416-57736438 CTCCAGGGTCAGCCCCGGGTGGG + Intronic
1102519126 12:113468110-113468132 ATCCAGGTGCGGCCCGGGGCGGG - Exonic
1105016268 12:132787908-132787930 ATCCGGGGGGGGTCCAGGGAAGG - Intronic
1113569623 13:111344658-111344680 ATCCGTGGGCTGCCCTGGGCCGG - Intergenic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1117424614 14:55580806-55580828 CTCCGGCGGCGTCCCCGGGCCGG + Intronic
1120190523 14:81436113-81436135 AGCCGCGGGCGTCCCGGGGTGGG - Intronic
1120745506 14:88147512-88147534 ATCCATGGGCAGCCACGGGTGGG - Intergenic
1120951927 14:90049590-90049612 ATCCTGGGGCTGCCCCTGATGGG + Intergenic
1122791225 14:104185034-104185056 AGCCGGGGGCGGCCCTGGTGGGG - Intergenic
1124140982 15:27077006-27077028 ATCAGAGGGCAGCCTCGGGTTGG - Intronic
1125921675 15:43528899-43528921 AGAGGGGGGCGGCGCCGGGTAGG + Exonic
1130520363 15:84657120-84657142 ATCCGGGGATGGCCCCAGCTGGG + Intronic
1132764720 16:1528627-1528649 ATGCGAGGGTGGCCCTGGGTGGG - Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1134482283 16:14630151-14630173 AGGCGGGCGCGGGCCCGGGTGGG - Exonic
1139438142 16:66948613-66948635 ACCCAGAGGCTGCCCCGGGTCGG - Intergenic
1142876204 17:2853416-2853438 ATCCGGGGCCGGGCCGGGGAGGG + Intronic
1151566191 17:74899886-74899908 ATCCTGGGGCAGCCCTGTGTTGG - Intergenic
1152617046 17:81342822-81342844 CTCCCGAGGCGGCCCCGGCTCGG - Intergenic
1160630931 18:80246510-80246532 ATCCGGGGGCGCGCTCGGGAGGG + Intronic
1160766023 19:808458-808480 AGGCCGGGGCGGCCCCGGGGTGG + Intronic
1160779043 19:869691-869713 CTCCGGGGAAGGCCCCGGCTCGG - Intronic
1161042989 19:2120050-2120072 AGCCGGGGCAGGCCCAGGGTGGG + Intronic
1161288486 19:3480487-3480509 AGCCAGCGGCGGTCCCGGGTCGG + Exonic
1161407443 19:4098544-4098566 AGCCGGGGGCGGACCCTGCTTGG - Intronic
1162965332 19:14152837-14152859 ATCCGTGAGTGCCCCCGGGTGGG + Exonic
1163390418 19:17027031-17027053 ATCCGGGGGCGAATCCGGGTAGG - Intergenic
1163455466 19:17403650-17403672 AGGAGGGGGCGGCCCCGGGAGGG - Intronic
1164713479 19:30375446-30375468 GGCCGGGGGCGCGCCCGGGTCGG - Intronic
1167463857 19:49640049-49640071 GGGCGGGGGCGGCCCCGGGGCGG - Exonic
1167549224 19:50148075-50148097 CTCCGGGGGCGGGCCCAAGTTGG - Intergenic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927888174 2:26731077-26731099 GTCCGGGGGCTGCCCGGGGTGGG - Exonic
935692796 2:105745380-105745402 ATCGGGGGCCGGCCCAGGGGCGG + Intronic
937751383 2:125479202-125479224 AGCAGGGGGCGGCGCCGGTTGGG + Intergenic
938252650 2:129827653-129827675 GTGCTGGGGCGCCCCCGGGTTGG + Intergenic
947992280 2:234497121-234497143 GTCCGGGGGCGGGTCCGGGGCGG - Intergenic
948231904 2:236355075-236355097 ACCCGGGAGGGGCCCAGGGTGGG - Intronic
1175767173 20:61599567-61599589 ATCTGGGGGCTGCCCCGCCTGGG - Intronic
1176150609 20:63588971-63588993 TTCAGGAGGCTGCCCCGGGTGGG - Exonic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180083084 21:45495349-45495371 ATCCCGGGGCGACCCTGGGGCGG - Exonic
1180091894 21:45537664-45537686 ATGCGGGGGCGGCCGCCAGTGGG - Intronic
1180955418 22:19739183-19739205 AACCTGGGGCGGGCACGGGTAGG + Intergenic
1181514344 22:23402617-23402639 GGCCGGGGGCGGACCCGGGCTGG + Intergenic
1183105256 22:35610832-35610854 ATGCGGGGAAGGCCTCGGGTGGG - Intronic
950538392 3:13594994-13595016 ATCCTGCGGCTGCCCCGGCTGGG + Intronic
968092982 3:195909614-195909636 ACTCGGGGGCGGCCCGGGGCGGG - Intronic
968914985 4:3493425-3493447 AGCCGGGGGTGGCCCCGCGTGGG - Exonic
969437004 4:7194056-7194078 ACCCTGGGGCAGCCCCTGGTGGG + Intronic
973279284 4:48341961-48341983 GTCGGGCGGCGGGCCCGGGTCGG + Exonic
976091294 4:81460676-81460698 AGCAGGGGGCGGCCAGGGGTGGG + Intronic
985727057 5:1522158-1522180 ATCCGGGGGCGTCCCCGCTGAGG + Intronic
985875554 5:2591420-2591442 GTCCAGGGGCTGCCCCAGGTAGG + Intergenic
1002054135 5:176589185-176589207 AACTGCGGGCGGCCCCGGGAGGG + Intronic
1002869947 6:1157581-1157603 AACCAGGGGCAGCCCCTGGTTGG + Intergenic
1005842521 6:29752953-29752975 ATCCGTGGGCGGCCCGTGGGAGG - Intergenic
1006033973 6:31197726-31197748 ATCCGTGGGCGGCCCGTGGGAGG + Intergenic
1006105022 6:31711261-31711283 ATAAGGAGGGGGCCCCGGGTGGG - Intronic
1019545021 7:1570008-1570030 TTCCGGGCGCGGCGCCGGCTTGG - Intronic
1020407563 7:7854684-7854706 ATCTGGGAGCGGCCAGGGGTGGG - Intronic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029680767 7:102107585-102107607 ATGCAGGGAGGGCCCCGGGTGGG - Intronic
1032011639 7:128351429-128351451 AGCCGGGGACGGGGCCGGGTTGG + Exonic
1035231366 7:157468037-157468059 AGCCGTGGGCGGCCCCAGGCGGG - Intergenic
1036789395 8:11708338-11708360 ACCGGGGGGCGGCCCGTGGTTGG - Exonic
1048968240 8:139629259-139629281 ATGCGGGGGCGCCCCTGGGGAGG + Intronic
1049102801 8:140591077-140591099 CTCTGGGTGCAGCCCCGGGTGGG + Intronic
1049368857 8:142253907-142253929 ATCAGTGGGCAGCCCTGGGTCGG - Intronic
1049404008 8:142443559-142443581 AGCCGGGGGCGGGCCTGGGTGGG + Intergenic
1049431854 8:142569050-142569072 AGCCGGGAGTGGCCCCAGGTAGG - Intergenic
1049431864 8:142569080-142569102 GGCCGGGAGCGGCCCCAGGTGGG - Intergenic
1049661221 8:143820477-143820499 CCCCAGGGGCGGTCCCGGGTGGG + Intronic
1051936247 9:22446723-22446745 AGCCGGGGGAGGGCCCGGGGCGG - Intergenic
1052362228 9:27573488-27573510 GCCCGGGGGCGGGCCCGGGGCGG - Intronic
1053135379 9:35647279-35647301 CTCCTGGGGAGGCCCAGGGTGGG + Intergenic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1057716678 9:97501599-97501621 AGCCAGGGGCGGGCCCGGCTCGG - Intronic
1059455671 9:114398560-114398582 AGCAGGGGGCGGCCCGGGGGGGG + Intergenic
1060479436 9:124009322-124009344 ATCTGGGGTCGGCCCAGCGTTGG + Intronic
1060643993 9:125262241-125262263 ACCGCGGGGCGGCCTCGGGTGGG + Intronic
1062499773 9:136847417-136847439 GCTCGGGGGCGGCCCTGGGTGGG - Exonic
1198276140 X:135097720-135097742 GGCTGGGGGCGGCCCCGGGAAGG - Intergenic
1198800132 X:140439716-140439738 GGCCGGGGGCGGGCCCGGGCTGG + Intergenic
1199365123 X:146971713-146971735 ATCCTGGGGCAGCCCTGAGTGGG - Intergenic
1199382247 X:147184058-147184080 ATCCTGGGGCAGCCCTGAGTGGG + Intergenic