ID: 1076792727

View in Genome Browser
Species Human (GRCh38)
Location 10:132785643-132785665
Sequence GCCGCGCGCCACAGCGGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076792725_1076792727 -7 Left 1076792725 10:132785627-132785649 CCAGGGGCTTGGGGTAGCCGCGC 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 137
1076792720_1076792727 6 Left 1076792720 10:132785614-132785636 CCCGGCAGCTCGGCCAGGGGCTT 0: 1
1: 1
2: 1
3: 30
4: 209
Right 1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 137
1076792713_1076792727 25 Left 1076792713 10:132785595-132785617 CCAGAAGATGGGCGGGCGCCCCG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 137
1076792719_1076792727 7 Left 1076792719 10:132785613-132785635 CCCCGGCAGCTCGGCCAGGGGCT 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 137
1076792721_1076792727 5 Left 1076792721 10:132785615-132785637 CCGGCAGCTCGGCCAGGGGCTTG 0: 1
1: 0
2: 1
3: 22
4: 242
Right 1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 137
1076792712_1076792727 30 Left 1076792712 10:132785590-132785612 CCGGGCCAGAAGATGGGCGGGCG 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076792727 Original CRISPR GCCGCGCGCCACAGCGGCCG CGG Exonic
900184919 1:1328496-1328518 GCCGCCTCCCGCAGCGGCCGTGG + Exonic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902870741 1:19312278-19312300 ACCGCGCGCCACCGCCCCCGCGG - Intergenic
904030482 1:27530406-27530428 GGCGCGCGCCACTGCGCCCAAGG + Intergenic
907850392 1:58249963-58249985 GCAGCCCTCCACAGCCGCCGCGG + Intronic
912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG + Intronic
912955881 1:114153816-114153838 GCCCCGCCCCAGTGCGGCCGGGG - Intronic
922744866 1:228038100-228038122 CCCGCGCCCCACCGCGGCCACGG - Intronic
1076713889 10:132353693-132353715 GCCACGGGCCACAGCTGCTGGGG + Intronic
1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG + Exonic
1076981932 11:209204-209226 GCCGCCCGCATCAGCGGACGCGG + Intronic
1078334177 11:10450890-10450912 GCCGCGCCCCGCAGCAGGCGCGG - Exonic
1079361995 11:19777272-19777294 CCCGCGCGCAGCAGCGGCCCCGG + Intronic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1082866436 11:57903916-57903938 GCCTCGCGCGACAGCAGCCTAGG - Intergenic
1083226181 11:61286313-61286335 GCCGACCGCCACAGCTGCCAAGG - Exonic
1084000189 11:66291903-66291925 TCCGCTCGGCTCAGCGGCCGCGG - Exonic
1084602640 11:70155278-70155300 GCCACGGGCCACAGAGGCGGAGG - Intronic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1092239553 12:6828572-6828594 GCTGCGCGCCTACGCGGCCGGGG + Exonic
1094375426 12:29783810-29783832 GCCGCGCGCCGCCGGGGCCCCGG - Exonic
1095810873 12:46372411-46372433 GCCGCGCGGGAAGGCGGCCGCGG - Intronic
1096255068 12:50057787-50057809 GCGGCGTGCCGCGGCGGCCGCGG + Exonic
1098991161 12:77065809-77065831 GACGCGGGCCCCGGCGGCCGCGG + Intergenic
1099989682 12:89709018-89709040 GCCGTCCGCAACAGCAGCCGCGG + Intronic
1100260663 12:92929344-92929366 GCCCCGCCCCCCGGCGGCCGCGG - Intergenic
1100391311 12:94148361-94148383 GCCGCCCGCCGCGGCCGCCGCGG - Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101354685 12:103966012-103966034 GCCGCCCGCATCAGCGGCCTCGG + Exonic
1103954246 12:124567580-124567602 TCCGCGCTCCCCGGCGGCCGCGG + Intronic
1110119609 13:71865797-71865819 GCCGCGCGCCCCGGCGAGCGCGG - Intronic
1110450725 13:75635904-75635926 GCCGCGCTCCCCAGCGGGGGAGG + Intronic
1117546596 14:56798415-56798437 GCCGCGGCCCACAGCGCCCTGGG + Intergenic
1121645712 14:95516266-95516288 GCAGCGCGCCCCAGCGGGCCGGG - Intronic
1122226863 14:100285454-100285476 GCCCCTCCCCACAGCGGACGCGG - Intergenic
1124118370 15:26867740-26867762 GCCGCGCGCCTCAGAGCCCCGGG - Intronic
1125508783 15:40282023-40282045 GCCCCGGGCCGCAGCGGCGGCGG + Exonic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1132365037 15:101251268-101251290 GCCGCGCGCCCCGCCGGCCTGGG + Exonic
1132398006 15:101488881-101488903 TGCGCGCGCCAAGGCGGCCGCGG - Intronic
1132978210 16:2720998-2721020 GGCGCGCGCCAGCGCGGCCCAGG + Intergenic
1133035068 16:3029835-3029857 GCCCCGCACCCCAGCGGCCCAGG + Intronic
1136867914 16:33771029-33771051 GCGGAGCGCCGCAGCGGCCAAGG - Intergenic
1137655115 16:50153098-50153120 GCCGTGCGTCACAGAGGCCGCGG - Intronic
1140500944 16:75433118-75433140 GCCTCGGGCCGGAGCGGCCGAGG + Intronic
1140517687 16:75556039-75556061 GCCTCGTGGCACAGCGGCCGGGG + Intronic
1141994117 16:87626125-87626147 GCCAAGAGCAACAGCGGCCGGGG + Intronic
1142206470 16:88785320-88785342 GCCGCGCGGGACAGCGGAGGGGG - Intergenic
1142338982 16:89508472-89508494 CCTGGGCCCCACAGCGGCCGAGG - Exonic
1143904633 17:10198767-10198789 TCCGCGCGCCAGGGCGGCCCCGG - Intergenic
1148489182 17:48012365-48012387 GCCGCGCGCCCCGGAGGCCGCGG + Intergenic
1148564682 17:48625942-48625964 GCCGCGCGGCGAAGCGGCCCCGG - Exonic
1148759696 17:49993361-49993383 CCCGCGCGCCCCCGCGGCCCTGG + Intronic
1149903810 17:60506756-60506778 GGCGCGAGCCACCGCGCCCGGGG - Intronic
1152363577 17:79843283-79843305 GCCGCGCGGCACTGCAGCCGGGG + Intergenic
1152744214 17:82031686-82031708 GCCCGGCGCCGCAGCGGCCGCGG - Exonic
1152756794 17:82090375-82090397 GCCGGGCGCCATGGCAGCCGTGG - Exonic
1155392459 18:25351009-25351031 GCCGCGCGCCCCTCGGGCCGCGG + Intronic
1157384315 18:47248365-47248387 GCCTCCGGCCACCGCGGCCGCGG + Intronic
1158591579 18:58783025-58783047 GCAGCTCACCACAGAGGCCGAGG + Intergenic
1160404704 18:78637716-78637738 GCCGAGCGGCACATTGGCCGGGG + Intergenic
1160453545 18:78980490-78980512 GCCCCGCGCCAGGCCGGCCGCGG + Intronic
1160909925 19:1469671-1469693 GCCGCGCGCCGCAGCAGCGACGG + Exonic
1160968602 19:1757570-1757592 GCCGCGCGGCCCCGCGGCCGCGG + Intronic
1161101820 19:2425278-2425300 GCCCCGCACCACCGCGGCCCCGG - Intronic
1161925131 19:7294131-7294153 GGCCCGGGCCGCAGCGGCCGGGG - Intergenic
1161950956 19:7467663-7467685 GCCGCCCGACACACTGGCCGAGG + Exonic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1166364837 19:42273082-42273104 GCTGCTCGCCAGGGCGGCCGGGG - Intronic
924962316 2:46122-46144 CCTGCGCGCCACCGGGGCCGGGG + Exonic
925036728 2:692699-692721 GCCGCAGGCCCCAGAGGCCGTGG - Intergenic
927904618 2:26847943-26847965 GCCGCGCGCCGCCGCCGCCTGGG - Intronic
929218040 2:39436857-39436879 GCCGCGCGCCGCCGAGGCCGTGG - Intronic
932567684 2:72919976-72919998 CCCGCGGGCCGCCGCGGCCGAGG + Intronic
941366978 2:164621448-164621470 GCCGCGCGTCTCAGCCGCCGGGG - Exonic
942043368 2:172085239-172085261 GCCGCGGGCCGCAGGGGCCCCGG + Exonic
943875348 2:193060757-193060779 GGCGCCCGCCACCGCGCCCGAGG + Intergenic
948368914 2:237475265-237475287 GGCGCGCGGAACTGCGGCCGGGG + Intergenic
948840022 2:240644312-240644334 GCCTCCCCCAACAGCGGCCGTGG + Intergenic
948983973 2:241508805-241508827 GCCGCGCGCCTGGGCGGGCGGGG + Intronic
1170634491 20:18092773-18092795 GGCGTGAGCCACAGCGCCCGGGG + Intergenic
1172064234 20:32207813-32207835 CCCGCGGGCTAGAGCGGCCGGGG + Intergenic
1176550194 21:8217424-8217446 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1176569122 21:8400462-8400484 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1176577036 21:8444694-8444716 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1177338100 21:19759972-19759994 GCAGCGCGCCACAGCCACTGGGG + Intergenic
1177515035 21:22138483-22138505 CCCCCGCGCCACGGCGGCCTGGG - Intergenic
1179968078 21:44818250-44818272 CCCGCGCCCCACAGCGCCCTAGG - Intronic
1180005623 21:45019161-45019183 GGAACGCGCGACAGCGGCCGGGG - Intergenic
1182435436 22:30326833-30326855 GCCGCGCGCGCCCGCGGCCGGGG - Exonic
1182664032 22:31944525-31944547 GGCGCGAGCCACAGCGCGCGGGG + Exonic
1183201313 22:36387466-36387488 GGCGCGTGCCCCAGCGGCTGGGG + Intronic
1203255089 22_KI270733v1_random:133762-133784 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1203263145 22_KI270733v1_random:178841-178863 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
950252966 3:11482228-11482250 GCTGGGCGCCACAGCAGCTGTGG + Intronic
950474005 3:13204382-13204404 GCACCGCCCCACATCGGCCGAGG + Intergenic
961057304 3:123799957-123799979 GCCGGGCGCCACAGAGCCCAGGG + Intronic
962367457 3:134795827-134795849 CCCGCGCTCGGCAGCGGCCGAGG - Intronic
964569733 3:158098149-158098171 GCCGCTCGCCACGCTGGCCGCGG - Exonic
968506448 4:973363-973385 GCCGCGCGCGCCCGGGGCCGGGG - Exonic
968835792 4:2963577-2963599 GCCCCTCGCCGCCGCGGCCGGGG - Intergenic
970156118 4:13143345-13143367 GCAGCGCCCCACAGCCACCGAGG - Intergenic
970456104 4:16226159-16226181 GCCGCGCGGCTCGGGGGCCGGGG + Intronic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
989011518 5:36877123-36877145 GTCTCTCGCCACAGCGGCCTCGG + Exonic
990828715 5:59931980-59932002 GCCGCGCCCCACAGTGGCTCAGG - Intronic
995784879 5:115816944-115816966 GTCGCGAACCACAGCGGCGGAGG - Exonic
1002190144 5:177473637-177473659 GCCGAGCGAGCCAGCGGCCGGGG + Intronic
1004720646 6:18264895-18264917 GCCGCGCCCCTCCGCGGCCCGGG - Intergenic
1006148312 6:31972176-31972198 GCCGGGCCCCACGCCGGCCGCGG - Exonic
1007032374 6:38639917-38639939 GACGCGCGCCGCAGCAGCCGGGG - Exonic
1011734417 6:90296973-90296995 GTACCGCGCCCCAGCGGCCGGGG - Intergenic
1013012667 6:106134377-106134399 GACGAGCGCCACAGCAGCCATGG + Intergenic
1019088327 6:169502222-169502244 GCCGCGCTCTTCAGAGGCCGCGG - Intronic
1019097024 6:169590573-169590595 GCCGCCCGCCACACCAGCCATGG + Intronic
1019215104 6:170438503-170438525 GCCGAGAGGCACAGAGGCCGGGG - Intergenic
1020445415 7:8262272-8262294 GCAGCGCAGCGCAGCGGCCGGGG + Exonic
1021230937 7:18086321-18086343 GGCGCGCACCTGAGCGGCCGGGG + Intergenic
1021828007 7:24573635-24573657 GCCGCGCGCCGGGCCGGCCGGGG + Intronic
1024255494 7:47537285-47537307 GCCGCGCGCCGCAGCCTCCACGG + Intronic
1026805878 7:73429466-73429488 GCAGGGCGCCCCAGGGGCCGTGG - Intergenic
1033099924 7:138460924-138460946 CCCGGGCTCCCCAGCGGCCGCGG - Intronic
1034223003 7:149460194-149460216 GCCGCGCGCAGTAGCGGCGGCGG - Intronic
1034911670 7:155002985-155003007 GCCGGGCGCCGCGGGGGCCGGGG - Exonic
1035328544 7:158081483-158081505 GCCTGGAGCCACAGCGGCCTTGG - Intronic
1035751813 8:2001852-2001874 GCAGCGCGCCACCGACGCCGTGG + Exonic
1039453828 8:37695594-37695616 GCCGCGCGCCGCCGCTGCCTCGG - Intergenic
1039868854 8:41528951-41528973 GGCGCCCGCCACCGCGGCCAAGG - Intergenic
1039921307 8:41896258-41896280 GCCGCGCCCCACCGCGTCCCGGG + Intronic
1042532837 8:69832881-69832903 GCCGCGTGCCACAGGGGGCAGGG + Exonic
1048484235 8:134832208-134832230 GCCGCGCGCCATGACGGACGCGG - Intergenic
1049557768 8:143291567-143291589 GCCGCGCCCGAGAGCGGCTGGGG - Exonic
1049573211 8:143379089-143379111 GCCGTGCCCCACCGCGGCCCGGG - Intronic
1053434869 9:38068120-38068142 GCGGCCCGCCACGCCGGCCGAGG - Exonic
1055501470 9:76906268-76906290 CCCACGCGCCACGGCGCCCGAGG - Intergenic
1062341385 9:136095213-136095235 GCGGCGCGCCGCAGCTGCCCAGG - Exonic
1062372206 9:136245771-136245793 GCTGCGCGCCACCGCCGCCCCGG + Exonic
1062549528 9:137079533-137079555 GCCCTGGGCCACAGCGGCTGTGG + Intronic
1062579178 9:137222010-137222032 GCCGCGCGCCGCCGCCGCAGAGG + Intergenic
1203471487 Un_GL000220v1:116899-116921 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1203479308 Un_GL000220v1:160871-160893 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1192795742 X:74422765-74422787 GCCGAGCCCCAGAGCGGGCGGGG + Intronic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic
1200128907 X:153830642-153830664 GCCGCGCGCCTCCCCGCCCGCGG + Intergenic
1200217476 X:154374446-154374468 GCCGCGCTCCTCGTCGGCCGGGG - Intronic
1200418257 Y:2935453-2935475 CCCGCGTGCCCCCGCGGCCGCGG + Intronic