ID: 1076793105

View in Genome Browser
Species Human (GRCh38)
Location 10:132786929-132786951
Sequence CAGGGCCCGAACGTGGGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793088_1076793105 28 Left 1076793088 10:132786878-132786900 CCCCGGCCGGGAGAACAGAGACC No data
Right 1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG No data
1076793092_1076793105 22 Left 1076793092 10:132786884-132786906 CCGGGAGAACAGAGACCAGGACG No data
Right 1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG No data
1076793095_1076793105 7 Left 1076793095 10:132786899-132786921 CCAGGACGGCCTCAGCGCGGAAG No data
Right 1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG No data
1076793096_1076793105 -2 Left 1076793096 10:132786908-132786930 CCTCAGCGCGGAAGCCCTGTCCA No data
Right 1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG No data
1076793090_1076793105 26 Left 1076793090 10:132786880-132786902 CCGGCCGGGAGAACAGAGACCAG No data
Right 1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG No data
1076793089_1076793105 27 Left 1076793089 10:132786879-132786901 CCCGGCCGGGAGAACAGAGACCA No data
Right 1076793105 10:132786929-132786951 CAGGGCCCGAACGTGGGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793105 Original CRISPR CAGGGCCCGAACGTGGGTGC GGG Intergenic
No off target data available for this crispr