ID: 1076793326

View in Genome Browser
Species Human (GRCh38)
Location 10:132787698-132787720
Sequence CGTCGCCTTGGGGTGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793326_1076793341 18 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793341 10:132787739-132787761 CGGGCTCTGAGCTGAGACGCGGG No data
1076793326_1076793344 28 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793344 10:132787749-132787771 GCTGAGACGCGGGAACTGCGGGG No data
1076793326_1076793342 26 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793342 10:132787747-132787769 GAGCTGAGACGCGGGAACTGCGG No data
1076793326_1076793335 -1 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793335 10:132787720-132787742 GGCGCCCGCGCCCAAGGCTCGGG No data
1076793326_1076793334 -2 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793334 10:132787719-132787741 CGGCGCCCGCGCCCAAGGCTCGG No data
1076793326_1076793340 17 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793340 10:132787738-132787760 TCGGGCTCTGAGCTGAGACGCGG No data
1076793326_1076793343 27 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793326_1076793333 -7 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793326 Original CRISPR CGTCGCCTTGGGGTGCTGGG AGG (reversed) Intergenic