ID: 1076793328

View in Genome Browser
Species Human (GRCh38)
Location 10:132787701-132787723
Sequence CGCCGTCGCCTTGGGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793328_1076793346 30 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793346 10:132787754-132787776 GACGCGGGAACTGCGGGGCCGGG No data
1076793328_1076793344 25 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793344 10:132787749-132787771 GCTGAGACGCGGGAACTGCGGGG No data
1076793328_1076793345 29 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793345 10:132787753-132787775 AGACGCGGGAACTGCGGGGCCGG No data
1076793328_1076793335 -4 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793335 10:132787720-132787742 GGCGCCCGCGCCCAAGGCTCGGG No data
1076793328_1076793343 24 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793328_1076793341 15 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793341 10:132787739-132787761 CGGGCTCTGAGCTGAGACGCGGG No data
1076793328_1076793333 -10 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793328_1076793334 -5 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793334 10:132787719-132787741 CGGCGCCCGCGCCCAAGGCTCGG No data
1076793328_1076793340 14 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793340 10:132787738-132787760 TCGGGCTCTGAGCTGAGACGCGG No data
1076793328_1076793342 23 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793342 10:132787747-132787769 GAGCTGAGACGCGGGAACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793328 Original CRISPR CGCCGTCGCCTTGGGGTGCT GGG (reversed) Intergenic