ID: 1076793329

View in Genome Browser
Species Human (GRCh38)
Location 10:132787702-132787724
Sequence GCGCCGTCGCCTTGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793329_1076793345 28 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793345 10:132787753-132787775 AGACGCGGGAACTGCGGGGCCGG No data
1076793329_1076793334 -6 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793334 10:132787719-132787741 CGGCGCCCGCGCCCAAGGCTCGG No data
1076793329_1076793342 22 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793342 10:132787747-132787769 GAGCTGAGACGCGGGAACTGCGG No data
1076793329_1076793347 30 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793329_1076793346 29 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793346 10:132787754-132787776 GACGCGGGAACTGCGGGGCCGGG No data
1076793329_1076793340 13 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793340 10:132787738-132787760 TCGGGCTCTGAGCTGAGACGCGG No data
1076793329_1076793341 14 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793341 10:132787739-132787761 CGGGCTCTGAGCTGAGACGCGGG No data
1076793329_1076793344 24 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793344 10:132787749-132787771 GCTGAGACGCGGGAACTGCGGGG No data
1076793329_1076793335 -5 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793335 10:132787720-132787742 GGCGCCCGCGCCCAAGGCTCGGG No data
1076793329_1076793343 23 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793329 Original CRISPR GCGCCGTCGCCTTGGGGTGC TGG (reversed) Intergenic