ID: 1076793331

View in Genome Browser
Species Human (GRCh38)
Location 10:132787709-132787731
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793331_1076793347 23 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793331_1076793345 21 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793345 10:132787753-132787775 AGACGCGGGAACTGCGGGGCCGG No data
1076793331_1076793340 6 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793340 10:132787738-132787760 TCGGGCTCTGAGCTGAGACGCGG No data
1076793331_1076793344 17 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793344 10:132787749-132787771 GCTGAGACGCGGGAACTGCGGGG No data
1076793331_1076793348 24 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793348 10:132787756-132787778 CGCGGGAACTGCGGGGCCGGGGG No data
1076793331_1076793349 25 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793331_1076793346 22 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793346 10:132787754-132787776 GACGCGGGAACTGCGGGGCCGGG No data
1076793331_1076793351 27 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793351 10:132787759-132787781 GGGAACTGCGGGGCCGGGGGGGG No data
1076793331_1076793350 26 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793350 10:132787758-132787780 CGGGAACTGCGGGGCCGGGGGGG No data
1076793331_1076793343 16 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793331_1076793341 7 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793341 10:132787739-132787761 CGGGCTCTGAGCTGAGACGCGGG No data
1076793331_1076793342 15 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793342 10:132787747-132787769 GAGCTGAGACGCGGGAACTGCGG No data
1076793331_1076793352 30 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793352 10:132787762-132787784 AACTGCGGGGCCGGGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793331 Original CRISPR GGCGCGGGCGCCGTCGCCTT GGG (reversed) Intergenic