ID: 1076793332

View in Genome Browser
Species Human (GRCh38)
Location 10:132787710-132787732
Sequence GGGCGCGGGCGCCGTCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793332_1076793343 15 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793332_1076793352 29 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793352 10:132787762-132787784 AACTGCGGGGCCGGGGGGGGCGG No data
1076793332_1076793353 30 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793353 10:132787763-132787785 ACTGCGGGGCCGGGGGGGGCGGG No data
1076793332_1076793349 24 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793332_1076793342 14 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793342 10:132787747-132787769 GAGCTGAGACGCGGGAACTGCGG No data
1076793332_1076793347 22 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793332_1076793340 5 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793340 10:132787738-132787760 TCGGGCTCTGAGCTGAGACGCGG No data
1076793332_1076793348 23 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793348 10:132787756-132787778 CGCGGGAACTGCGGGGCCGGGGG No data
1076793332_1076793345 20 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793345 10:132787753-132787775 AGACGCGGGAACTGCGGGGCCGG No data
1076793332_1076793351 26 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793351 10:132787759-132787781 GGGAACTGCGGGGCCGGGGGGGG No data
1076793332_1076793344 16 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793344 10:132787749-132787771 GCTGAGACGCGGGAACTGCGGGG No data
1076793332_1076793346 21 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793346 10:132787754-132787776 GACGCGGGAACTGCGGGGCCGGG No data
1076793332_1076793341 6 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793341 10:132787739-132787761 CGGGCTCTGAGCTGAGACGCGGG No data
1076793332_1076793350 25 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793350 10:132787758-132787780 CGGGAACTGCGGGGCCGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793332 Original CRISPR GGGCGCGGGCGCCGTCGCCT TGG (reversed) Intergenic