HTGT WGE

Individual CRISPR Summary

ID: 1076793333

 View in Genome Browser
Species Human (GRCh38)
Location 10:132787714-132787736
Sequence GGCGACGGCGCCCGCGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793320_1076793333 15 Left 1076793320 10:132787676-132787698 CCTCCCGGGTCGGGTTCGGGCCC No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793324_1076793333 -5 Left 1076793324 10:132787696-132787718 CCCCTCCCAGCACCCCAAGGCGA No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793322_1076793333 11 Left 1076793322 10:132787680-132787702 CCGGGTCGGGTTCGGGCCCCTCC No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793326_1076793333 -7 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793321_1076793333 12 Left 1076793321 10:132787679-132787701 CCCGGGTCGGGTTCGGGCCCCTC No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793328_1076793333 -10 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793319_1076793333 16 Left 1076793319 10:132787675-132787697 CCCTCCCGGGTCGGGTTCGGGCC No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data
1076793325_1076793333 -6 Left 1076793325 10:132787697-132787719 CCCTCCCAGCACCCCAAGGCGAC No data
Right 1076793333 10:132787714-132787736 GGCGACGGCGCCCGCGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793333 Original CRISPR GGCGACGGCGCCCGCGCCCA AGG Intergenic