ID: 1076793337

View in Genome Browser
Species Human (GRCh38)
Location 10:132787725-132787747
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793337_1076793347 7 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793337_1076793359 28 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG 0: 1
1: 3
2: 25
3: 268
4: 2756
1076793337_1076793361 30 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793361 10:132787778-132787800 GGGGCGGGCAGGGGGAGTTGGGG No data
1076793337_1076793343 0 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793337_1076793348 8 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793348 10:132787756-132787778 CGCGGGAACTGCGGGGCCGGGGG No data
1076793337_1076793355 20 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793355 10:132787768-132787790 GGGGCCGGGGGGGGCGGGCAGGG No data
1076793337_1076793351 11 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793351 10:132787759-132787781 GGGAACTGCGGGGCCGGGGGGGG No data
1076793337_1076793354 19 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793354 10:132787767-132787789 CGGGGCCGGGGGGGGCGGGCAGG No data
1076793337_1076793342 -1 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793342 10:132787747-132787769 GAGCTGAGACGCGGGAACTGCGG No data
1076793337_1076793346 6 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793346 10:132787754-132787776 GACGCGGGAACTGCGGGGCCGGG No data
1076793337_1076793356 21 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793356 10:132787769-132787791 GGGCCGGGGGGGGCGGGCAGGGG 0: 1
1: 1
2: 38
3: 436
4: 3210
1076793337_1076793350 10 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793350 10:132787758-132787780 CGGGAACTGCGGGGCCGGGGGGG No data
1076793337_1076793340 -10 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793340 10:132787738-132787760 TCGGGCTCTGAGCTGAGACGCGG No data
1076793337_1076793353 15 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793353 10:132787763-132787785 ACTGCGGGGCCGGGGGGGGCGGG No data
1076793337_1076793349 9 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793337_1076793344 1 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793344 10:132787749-132787771 GCTGAGACGCGGGAACTGCGGGG No data
1076793337_1076793345 5 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793345 10:132787753-132787775 AGACGCGGGAACTGCGGGGCCGG No data
1076793337_1076793357 22 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793357 10:132787770-132787792 GGCCGGGGGGGGCGGGCAGGGGG No data
1076793337_1076793341 -9 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793341 10:132787739-132787761 CGGGCTCTGAGCTGAGACGCGGG No data
1076793337_1076793352 14 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793352 10:132787762-132787784 AACTGCGGGGCCGGGGGGGGCGG 0: 1
1: 0
2: 4
3: 106
4: 1498
1076793337_1076793360 29 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793360 10:132787777-132787799 GGGGGCGGGCAGGGGGAGTTGGG 0: 1
1: 1
2: 8
3: 108
4: 1027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793337 Original CRISPR CAGAGCCCGAGCCTTGGGCG CGG (reversed) Intergenic