ID: 1076793338

View in Genome Browser
Species Human (GRCh38)
Location 10:132787730-132787752
Sequence CAGCTCAGAGCCCGAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 22 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793338_1076793359 23 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG No data
1076793338_1076793362 26 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793362 10:132787779-132787801 GGGCGGGCAGGGGGAGTTGGGGG No data
1076793338_1076793352 9 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793352 10:132787762-132787784 AACTGCGGGGCCGGGGGGGGCGG No data
1076793338_1076793357 17 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793357 10:132787770-132787792 GGCCGGGGGGGGCGGGCAGGGGG No data
1076793338_1076793342 -6 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793342 10:132787747-132787769 GAGCTGAGACGCGGGAACTGCGG No data
1076793338_1076793355 15 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793355 10:132787768-132787790 GGGGCCGGGGGGGGCGGGCAGGG No data
1076793338_1076793354 14 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793354 10:132787767-132787789 CGGGGCCGGGGGGGGCGGGCAGG No data
1076793338_1076793350 5 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793350 10:132787758-132787780 CGGGAACTGCGGGGCCGGGGGGG No data
1076793338_1076793361 25 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793361 10:132787778-132787800 GGGGCGGGCAGGGGGAGTTGGGG No data
1076793338_1076793345 0 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793345 10:132787753-132787775 AGACGCGGGAACTGCGGGGCCGG No data
1076793338_1076793364 30 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793364 10:132787783-132787805 GGGCAGGGGGAGTTGGGGGCGGG No data
1076793338_1076793346 1 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793346 10:132787754-132787776 GACGCGGGAACTGCGGGGCCGGG No data
1076793338_1076793353 10 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793353 10:132787763-132787785 ACTGCGGGGCCGGGGGGGGCGGG No data
1076793338_1076793344 -4 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793344 10:132787749-132787771 GCTGAGACGCGGGAACTGCGGGG No data
1076793338_1076793363 29 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793363 10:132787782-132787804 CGGGCAGGGGGAGTTGGGGGCGG No data
1076793338_1076793348 3 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793348 10:132787756-132787778 CGCGGGAACTGCGGGGCCGGGGG No data
1076793338_1076793349 4 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793338_1076793356 16 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793356 10:132787769-132787791 GGGCCGGGGGGGGCGGGCAGGGG No data
1076793338_1076793347 2 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793338_1076793351 6 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793351 10:132787759-132787781 GGGAACTGCGGGGCCGGGGGGGG No data
1076793338_1076793360 24 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793360 10:132787777-132787799 GGGGGCGGGCAGGGGGAGTTGGG No data
1076793338_1076793343 -5 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793338 Original CRISPR CAGCTCAGAGCCCGAGCCTT GGG (reversed) Intergenic