ID: 1076793343

View in Genome Browser
Species Human (GRCh38)
Location 10:132787748-132787770
Sequence AGCTGAGACGCGGGAACTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793337_1076793343 0 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793324_1076793343 29 Left 1076793324 10:132787696-132787718 CCCCTCCCAGCACCCCAAGGCGA No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793326_1076793343 27 Left 1076793326 10:132787698-132787720 CCTCCCAGCACCCCAAGGCGACG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793330_1076793343 17 Left 1076793330 10:132787708-132787730 CCCCAAGGCGACGGCGCCCGCGC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793329_1076793343 23 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793336_1076793343 1 Left 1076793336 10:132787724-132787746 CCCGCGCCCAAGGCTCGGGCTCT No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793328_1076793343 24 Left 1076793328 10:132787701-132787723 CCCAGCACCCCAAGGCGACGGCG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793339_1076793343 -6 Left 1076793339 10:132787731-132787753 CCAAGGCTCGGGCTCTGAGCTGA No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793331_1076793343 16 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793325_1076793343 28 Left 1076793325 10:132787697-132787719 CCCTCCCAGCACCCCAAGGCGAC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793338_1076793343 -5 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data
1076793332_1076793343 15 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793343 10:132787748-132787770 AGCTGAGACGCGGGAACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793343 Original CRISPR AGCTGAGACGCGGGAACTGC GGG Intergenic