ID: 1076793347

View in Genome Browser
Species Human (GRCh38)
Location 10:132787755-132787777
Sequence ACGCGGGAACTGCGGGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793330_1076793347 24 Left 1076793330 10:132787708-132787730 CCCCAAGGCGACGGCGCCCGCGC No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793331_1076793347 23 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793332_1076793347 22 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793336_1076793347 8 Left 1076793336 10:132787724-132787746 CCCGCGCCCAAGGCTCGGGCTCT No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793329_1076793347 30 Left 1076793329 10:132787702-132787724 CCAGCACCCCAAGGCGACGGCGC No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793339_1076793347 1 Left 1076793339 10:132787731-132787753 CCAAGGCTCGGGCTCTGAGCTGA No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793337_1076793347 7 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data
1076793338_1076793347 2 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793347 10:132787755-132787777 ACGCGGGAACTGCGGGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793347 Original CRISPR ACGCGGGAACTGCGGGGCCG GGG Intergenic