ID: 1076793349

View in Genome Browser
Species Human (GRCh38)
Location 10:132787757-132787779
Sequence GCGGGAACTGCGGGGCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793339_1076793349 3 Left 1076793339 10:132787731-132787753 CCAAGGCTCGGGCTCTGAGCTGA No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793338_1076793349 4 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793337_1076793349 9 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793332_1076793349 24 Left 1076793332 10:132787710-132787732 CCAAGGCGACGGCGCCCGCGCCC No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793336_1076793349 10 Left 1076793336 10:132787724-132787746 CCCGCGCCCAAGGCTCGGGCTCT No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793330_1076793349 26 Left 1076793330 10:132787708-132787730 CCCCAAGGCGACGGCGCCCGCGC No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data
1076793331_1076793349 25 Left 1076793331 10:132787709-132787731 CCCAAGGCGACGGCGCCCGCGCC No data
Right 1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793349 Original CRISPR GCGGGAACTGCGGGGCCGGG GGG Intergenic