ID: 1076793359

View in Genome Browser
Species Human (GRCh38)
Location 10:132787776-132787798
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793338_1076793359 23 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG No data
1076793337_1076793359 28 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG No data
1076793339_1076793359 22 Left 1076793339 10:132787731-132787753 CCAAGGCTCGGGCTCTGAGCTGA No data
Right 1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG No data
1076793336_1076793359 29 Left 1076793336 10:132787724-132787746 CCCGCGCCCAAGGCTCGGGCTCT No data
Right 1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793359 Original CRISPR GGGGGGCGGGCAGGGGGAGT TGG Intergenic