ID: 1076793360

View in Genome Browser
Species Human (GRCh38)
Location 10:132787777-132787799
Sequence GGGGGCGGGCAGGGGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793338_1076793360 24 Left 1076793338 10:132787730-132787752 CCCAAGGCTCGGGCTCTGAGCTG No data
Right 1076793360 10:132787777-132787799 GGGGGCGGGCAGGGGGAGTTGGG No data
1076793336_1076793360 30 Left 1076793336 10:132787724-132787746 CCCGCGCCCAAGGCTCGGGCTCT No data
Right 1076793360 10:132787777-132787799 GGGGGCGGGCAGGGGGAGTTGGG No data
1076793337_1076793360 29 Left 1076793337 10:132787725-132787747 CCGCGCCCAAGGCTCGGGCTCTG No data
Right 1076793360 10:132787777-132787799 GGGGGCGGGCAGGGGGAGTTGGG No data
1076793339_1076793360 23 Left 1076793339 10:132787731-132787753 CCAAGGCTCGGGCTCTGAGCTGA No data
Right 1076793360 10:132787777-132787799 GGGGGCGGGCAGGGGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793360 Original CRISPR GGGGGCGGGCAGGGGGAGTT GGG Intergenic