ID: 1076793362 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:132787779-132787801 |
Sequence | GGGCGGGCAGGGGGAGTTGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076793338_1076793362 | 26 | Left | 1076793338 | 10:132787730-132787752 | CCCAAGGCTCGGGCTCTGAGCTG | No data | ||
Right | 1076793362 | 10:132787779-132787801 | GGGCGGGCAGGGGGAGTTGGGGG | No data | ||||
1076793339_1076793362 | 25 | Left | 1076793339 | 10:132787731-132787753 | CCAAGGCTCGGGCTCTGAGCTGA | No data | ||
Right | 1076793362 | 10:132787779-132787801 | GGGCGGGCAGGGGGAGTTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076793362 | Original CRISPR | GGGCGGGCAGGGGGAGTTGG GGG | Intergenic | ||