ID: 1076793591

View in Genome Browser
Species Human (GRCh38)
Location 10:132788556-132788578
Sequence GTGGCATCGCGGACCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076793591_1076793599 8 Left 1076793591 10:132788556-132788578 CCTGGAGAGGTCCGCGATGCCAC No data
Right 1076793599 10:132788587-132788609 CCGCGAGCAGATGTCCCGCGAGG No data
1076793591_1076793604 25 Left 1076793591 10:132788556-132788578 CCTGGAGAGGTCCGCGATGCCAC No data
Right 1076793604 10:132788604-132788626 GCGAGGAAGGCTGCCGGCATCGG No data
1076793591_1076793601 19 Left 1076793591 10:132788556-132788578 CCTGGAGAGGTCCGCGATGCCAC No data
Right 1076793601 10:132788598-132788620 TGTCCCGCGAGGAAGGCTGCCGG No data
1076793591_1076793600 12 Left 1076793591 10:132788556-132788578 CCTGGAGAGGTCCGCGATGCCAC No data
Right 1076793600 10:132788591-132788613 GAGCAGATGTCCCGCGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076793591 Original CRISPR GTGGCATCGCGGACCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr