ID: 1076794387

View in Genome Browser
Species Human (GRCh38)
Location 10:132791563-132791585
Sequence CAGTGGAGCTGGGGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076794368_1076794387 29 Left 1076794368 10:132791511-132791533 CCCTCCCAGGAGGACACCCGGGG No data
Right 1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG No data
1076794372_1076794387 25 Left 1076794372 10:132791515-132791537 CCCAGGAGGACACCCGGGGGTGC No data
Right 1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG No data
1076794376_1076794387 13 Left 1076794376 10:132791527-132791549 CCCGGGGGTGCTGGGTGCAGACA No data
Right 1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG No data
1076794373_1076794387 24 Left 1076794373 10:132791516-132791538 CCAGGAGGACACCCGGGGGTGCT No data
Right 1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG No data
1076794377_1076794387 12 Left 1076794377 10:132791528-132791550 CCGGGGGTGCTGGGTGCAGACAG No data
Right 1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG No data
1076794370_1076794387 28 Left 1076794370 10:132791512-132791534 CCTCCCAGGAGGACACCCGGGGG No data
Right 1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076794387 Original CRISPR CAGTGGAGCTGGGGGGAAGA GGG Intergenic
No off target data available for this crispr