ID: 1076794397

View in Genome Browser
Species Human (GRCh38)
Location 10:132791604-132791626
Sequence GCCCCTGCCGAGGGGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076794397_1076794413 24 Left 1076794397 10:132791604-132791626 CCACAGGACCCCTCGGCAGGGGC No data
Right 1076794413 10:132791651-132791673 ACGCCATCTGAGGAAGAGGAGGG No data
1076794397_1076794412 23 Left 1076794397 10:132791604-132791626 CCACAGGACCCCTCGGCAGGGGC No data
Right 1076794412 10:132791650-132791672 GACGCCATCTGAGGAAGAGGAGG No data
1076794397_1076794408 14 Left 1076794397 10:132791604-132791626 CCACAGGACCCCTCGGCAGGGGC No data
Right 1076794408 10:132791641-132791663 CGACACCCAGACGCCATCTGAGG No data
1076794397_1076794414 25 Left 1076794397 10:132791604-132791626 CCACAGGACCCCTCGGCAGGGGC No data
Right 1076794414 10:132791652-132791674 CGCCATCTGAGGAAGAGGAGGGG No data
1076794397_1076794411 20 Left 1076794397 10:132791604-132791626 CCACAGGACCCCTCGGCAGGGGC No data
Right 1076794411 10:132791647-132791669 CCAGACGCCATCTGAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076794397 Original CRISPR GCCCCTGCCGAGGGGTCCTG TGG (reversed) Intergenic
No off target data available for this crispr