ID: 1076797644

View in Genome Browser
Species Human (GRCh38)
Location 10:132805905-132805927
Sequence CTGGCCGGGGGAGCGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076797628_1076797644 12 Left 1076797628 10:132805870-132805892 CCTCTGACATCCGAGAGGCCCGG No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797624_1076797644 21 Left 1076797624 10:132805861-132805883 CCCAGGGGCCCTCTGACATCCGA No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797621_1076797644 29 Left 1076797621 10:132805853-132805875 CCCCTGGTCCCAGGGGCCCTCTG No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797623_1076797644 27 Left 1076797623 10:132805855-132805877 CCTGGTCCCAGGGGCCCTCTGAC No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797625_1076797644 20 Left 1076797625 10:132805862-132805884 CCAGGGGCCCTCTGACATCCGAG No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797622_1076797644 28 Left 1076797622 10:132805854-132805876 CCCTGGTCCCAGGGGCCCTCTGA No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797627_1076797644 13 Left 1076797627 10:132805869-132805891 CCCTCTGACATCCGAGAGGCCCG No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797636_1076797644 -6 Left 1076797636 10:132805888-132805910 CCCGGGCTGGGGACCCGCTGGCC No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797637_1076797644 -7 Left 1076797637 10:132805889-132805911 CCGGGCTGGGGACCCGCTGGCCG No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data
1076797634_1076797644 2 Left 1076797634 10:132805880-132805902 CCGAGAGGCCCGGGCTGGGGACC No data
Right 1076797644 10:132805905-132805927 CTGGCCGGGGGAGCGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076797644 Original CRISPR CTGGCCGGGGGAGCGTCTCC TGG Intergenic