ID: 1076798094

View in Genome Browser
Species Human (GRCh38)
Location 10:132808533-132808555
Sequence CAGCCCCGACGCAGACCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 188}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076798086_1076798094 13 Left 1076798086 10:132808497-132808519 CCGCCCTTGTCCTGGCCCCGGGA 0: 1
1: 0
2: 1
3: 22
4: 245
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798089_1076798094 3 Left 1076798089 10:132808507-132808529 CCTGGCCCCGGGAAGAGACGCAG 0: 1
1: 0
2: 3
3: 17
4: 202
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798092_1076798094 -4 Left 1076798092 10:132808514-132808536 CCGGGAAGAGACGCAGCTCCAGC 0: 1
1: 0
2: 0
3: 17
4: 257
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798088_1076798094 9 Left 1076798088 10:132808501-132808523 CCTTGTCCTGGCCCCGGGAAGAG 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798090_1076798094 -2 Left 1076798090 10:132808512-132808534 CCCCGGGAAGAGACGCAGCTCCA 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798082_1076798094 24 Left 1076798082 10:132808486-132808508 CCAAGGGGAGGCCGCCCTTGTCC 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798087_1076798094 10 Left 1076798087 10:132808500-132808522 CCCTTGTCCTGGCCCCGGGAAGA 0: 1
1: 0
2: 2
3: 22
4: 158
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798081_1076798094 27 Left 1076798081 10:132808483-132808505 CCGCCAAGGGGAGGCCGCCCTTG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188
1076798091_1076798094 -3 Left 1076798091 10:132808513-132808535 CCCGGGAAGAGACGCAGCTCCAG 0: 1
1: 1
2: 4
3: 29
4: 242
Right 1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076798094 Original CRISPR CAGCCCCGACGCAGACCCCA TGG Exonic
900146018 1:1158927-1158949 CAGTCCCTACCCAGGCCCCAGGG - Intergenic
900392318 1:2439029-2439051 CAGCCCTGACCCAGCTCCCAGGG + Intronic
900410074 1:2508393-2508415 CAGCCGCCCCGCAGACCCCATGG - Intergenic
900481977 1:2903859-2903881 CAGCCCCCACGGGGTCCCCAAGG + Intergenic
901660120 1:10794038-10794060 CAGCCCCGGCTCAGCCCCCGGGG + Intronic
901938521 1:12644594-12644616 CAGCCCAGACAAAGACCCCCAGG - Exonic
903960992 1:27057717-27057739 CTGCCCCTAGGCAGAACCCATGG + Intergenic
908581961 1:65525711-65525733 CGGCCCCATCGCAGAGCCCACGG + Intronic
908975736 1:69895566-69895588 CAGCCCCAACGGTGTCCCCAAGG + Intronic
910207142 1:84759406-84759428 CAGCCCCGACGCCCACTCCTCGG + Intergenic
916177562 1:162055359-162055381 CAGCCCCGACTCACCACCCAGGG + Intergenic
917228865 1:172814285-172814307 GAGCCCCCACAGAGACCCCACGG - Intergenic
917859687 1:179134421-179134443 CAGCCTCCACGCAGCCTCCATGG - Intronic
918142965 1:181733707-181733729 CATCCCCGACGTGGACCCCTTGG + Exonic
920358188 1:205391681-205391703 CCGCCTCCACGCACACCCCAAGG + Intronic
1064244365 10:13657356-13657378 CAGCAACGGCTCAGACCCCATGG - Exonic
1065529372 10:26653180-26653202 CAGCCCCGCCACACCCCCCAAGG + Intergenic
1067042302 10:42961597-42961619 CAGTCCTGACACAGCCCCCATGG + Intergenic
1067089753 10:43260557-43260579 CTCCCCAGACCCAGACCCCACGG + Intronic
1069753676 10:70760731-70760753 CAGCCCCAAGGCAGCCCCCCGGG - Exonic
1069773355 10:70913032-70913054 CAGCCCTGAGCCAGACCCTAAGG - Intergenic
1069778746 10:70941817-70941839 CAGCCCCAAAGCAGCCCCCCAGG - Intergenic
1070716257 10:78724240-78724262 CTGCCCAGAAGCAGACGCCAGGG - Intergenic
1072822778 10:98574640-98574662 CAGCCCTGAAGCAAAGCCCAGGG + Intronic
1073147053 10:101288002-101288024 CAGCCCCCACTCCCACCCCAAGG + Intergenic
1074563939 10:114559559-114559581 CTGCCCCGAGGGAGACCCCAGGG - Intronic
1074732462 10:116393504-116393526 CAGCCCCGACCCACCCGCCACGG + Intergenic
1076321946 10:129589655-129589677 CAGCCCCGCCGCAGGCCATAGGG - Intronic
1076547834 10:131257653-131257675 CAACCCCCAGGCAGCCCCCATGG - Intronic
1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG + Exonic
1077035029 11:490358-490380 CAGCCCCACTGCAGGCCCCATGG - Intronic
1077105828 11:842321-842343 CCGCCCCGGCGCGCACCCCAGGG + Intronic
1077184018 11:1228502-1228524 CAGCACCGTGGCAGCCCCCATGG + Intronic
1077267843 11:1661009-1661031 CAGCCCTGTCGCACTCCCCACGG + Intergenic
1077268821 11:1665695-1665717 CAGGCAGGACGCAGCCCCCAGGG + Intergenic
1077271932 11:1685485-1685507 CAGGCAGGACGCAGCCCCCAGGG - Intergenic
1078444375 11:11393154-11393176 CACCCCACACCCAGACCCCATGG - Intronic
1080404470 11:31966808-31966830 CTGCCCAGACTCAGACCCCCAGG - Intronic
1081966456 11:47173106-47173128 CAGCCCTGCCTCAGAGCCCAGGG + Intronic
1083651824 11:64208590-64208612 CAGCCGGCACGCAGCCCCCATGG - Intronic
1083701017 11:64477704-64477726 CCTCCCCGACTCAAACCCCACGG - Intergenic
1083723704 11:64617636-64617658 CAGCCTCGCTGGAGACCCCATGG - Intronic
1084312742 11:68326330-68326352 CAGCCCAGACGCAGATGGCAGGG - Intronic
1084972949 11:72781461-72781483 CAGTCCCCACGCCGGCCCCAGGG - Intronic
1094503627 12:31041753-31041775 CAGCCTCCAAGCAGGCCCCATGG - Intergenic
1094837238 12:34327878-34327900 CAGCCCCTACGCAGGGCCCCGGG - Intergenic
1103702898 12:122856842-122856864 CAGCCCTGACCCAGACCCAGGGG + Intronic
1104656032 12:130574727-130574749 CAGCCCCACCGCCCACCCCAGGG + Intronic
1105542783 13:21329095-21329117 CAGCTCCCACCCACACCCCAAGG + Intergenic
1105849683 13:24323047-24323069 CAGCCCCAAACCAGACACCAAGG + Intergenic
1107363038 13:39640445-39640467 GGGTCCCGACGCAGACCCCAAGG + Intergenic
1108704842 13:52975550-52975572 CAGTCCCACCGCAGGCCCCATGG - Intergenic
1113817303 13:113182176-113182198 AGGCCTCGACCCAGACCCCAGGG - Intronic
1113965211 13:114149088-114149110 CAGAACCGACTCAGCCCCCACGG - Intergenic
1118259234 14:64232344-64232366 CAGCACCCACGCTGGCCCCATGG + Intronic
1118952415 14:70446667-70446689 CAGCCACTACCCAGGCCCCAAGG - Intergenic
1119170214 14:72529224-72529246 CACACCCCATGCAGACCCCATGG - Intronic
1119616786 14:76104020-76104042 CAGCCCAGACACAGATTCCAGGG - Intergenic
1123114015 14:105885731-105885753 CAGCAGCGATGCAGACCCCTTGG + Intergenic
1123116238 14:105895349-105895371 CAGCAGCGATGCAGACCCCACGG + Intergenic
1123118192 14:105904197-105904219 CAGCAGCGATGCAGACCCCTCGG + Intergenic
1124014392 15:25863297-25863319 CCGCCCGGCCGCAGTCCCCAGGG + Intronic
1125771847 15:42173252-42173274 CAGACCTCAGGCAGACCCCAGGG + Intronic
1128883421 15:71264068-71264090 CTGCCCCAACACAGACGCCATGG + Intronic
1132503609 16:296183-296205 CAGCACCGATGGGGACCCCAAGG + Intronic
1132575580 16:662286-662308 CAGCTCCGACACAGCCCCCACGG - Exonic
1132604014 16:786099-786121 CACCCCCGACCCTGACCCCGAGG - Exonic
1132749957 16:1452937-1452959 CGGCCCCTCCGCAGGCCCCATGG + Intronic
1132824359 16:1895982-1896004 CAGGCCAGACACAGGCCCCACGG - Intergenic
1132872078 16:2119749-2119771 CAGCCCCCACACAGACTCGAGGG + Intronic
1134520447 16:14917147-14917169 CAGCCCCCACACAGACTCGAGGG - Intronic
1134551128 16:15138827-15138849 CAGCCCCCACACAGACTCGAGGG + Intronic
1134708119 16:16315798-16315820 CAGCCCCCACACAGACTCGAGGG - Intergenic
1134715334 16:16355831-16355853 CAGCCCCCACACAGACTCGAGGG - Intergenic
1134951483 16:18352847-18352869 CAGCCCCCACACAGACTCGAGGG + Intergenic
1134959423 16:18396328-18396350 CAGCCCCCACACAGACTCGAGGG + Intergenic
1136188682 16:28602537-28602559 CAACCCCGAGACAGACCCCGAGG + Intergenic
1136191152 16:28615531-28615553 CAACCCCGAGACAGACCCCGAGG + Intronic
1137293248 16:47066476-47066498 CAGACCCGACCCAGTGCCCAGGG - Intergenic
1138195015 16:55045473-55045495 CAGCCCCGGTGAAGATCCCAGGG - Intergenic
1139751680 16:69112791-69112813 CTGCCTCCAGGCAGACCCCAGGG - Intronic
1139993091 16:70955411-70955433 CAGCCCTGATGCAGAGCTCACGG + Exonic
1141577924 16:84976655-84976677 CTGCCCCGATCCAGACCCCGTGG + Intronic
1141825059 16:86472939-86472961 CAGCCAAGACACAGACCCCTCGG - Intergenic
1143863026 17:9904991-9905013 CTTCCCCGACACCGACCCCAAGG - Exonic
1144957621 17:19027127-19027149 CAGCACCCACACAGCCCCCAGGG - Intronic
1144977535 17:19147389-19147411 CAGCACCCACACAGCCCCCAGGG + Intronic
1146252572 17:31362202-31362224 AAGACCAGAAGCAGACCCCAGGG - Intronic
1150467107 17:65403147-65403169 GAGCCCCTCCACAGACCCCAGGG + Intergenic
1151642335 17:75405376-75405398 CCGCCCCGACGCGAACCCCGGGG + Exonic
1152527370 17:80896288-80896310 GAGCCCCCACTCAGACCCTAAGG - Intronic
1152567617 17:81107193-81107215 CAGCCCAGACGCTGCCCCCTTGG - Intronic
1152889935 17:82874550-82874572 CATCCCGGCCGCAGACCCAAGGG + Intronic
1153668282 18:7385853-7385875 CAGCCCCGACACAGGCTCCCAGG + Intergenic
1160272331 18:77398329-77398351 GAGCACCAACGCAGACCCTAAGG + Intergenic
1160708721 19:541066-541088 CCGCCCCGAAGCACAACCCAAGG - Intronic
1161031538 19:2059989-2060011 CAGCCCCTGCACAGTCCCCAAGG + Intergenic
1161248867 19:3270132-3270154 CAGCTCCAACCCTGACCCCATGG + Intronic
1161383748 19:3980198-3980220 CAGCCCCGACGCAGCAGTCAGGG - Intronic
1161454473 19:4363146-4363168 CTGCCCCGATGCAGGCCCCGGGG - Intronic
1161756406 19:6137379-6137401 CAGCCCGTACGAAGGCCCCAAGG + Intronic
1162372912 19:10289779-10289801 CGGCCTCCACGTAGACCCCAGGG + Intergenic
1163785563 19:19273240-19273262 CAGCCCCGACGCGTTCTCCAGGG + Exonic
1165781180 19:38435015-38435037 CAGCCCCTCAGCAGACACCATGG + Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1165940644 19:39413343-39413365 CGACCCCGACGCGGTCCCCAGGG - Exonic
1166959122 19:46487500-46487522 CAGCCCTGACAGGGACCCCAGGG + Intronic
1167145818 19:47680471-47680493 CGGCCCCGCCGCAGCCCCCCGGG + Exonic
1167576999 19:50322620-50322642 CAGACCCGAGGCAGAACCCCAGG - Intronic
925569465 2:5293682-5293704 CAGCCTCGAAGCAGAATCCAAGG + Intergenic
929511325 2:42568371-42568393 CAGCCAGGACCCTGACCCCAGGG + Intronic
930692366 2:54377730-54377752 CAGCCCCGACGCCAAGCCCAAGG - Intronic
937201577 2:120207424-120207446 CAGCCCCGCCCCAGGCCCCCGGG - Intergenic
937241038 2:120462919-120462941 CAGCTGGGATGCAGACCCCAGGG + Intergenic
938733066 2:134161305-134161327 CAGGCCCAACCCAGCCCCCAAGG - Intronic
941523139 2:166573870-166573892 CAGCCCTGATGCAGAGCCCATGG - Intergenic
945258521 2:207822920-207822942 CAGCCCAGAGGCAGGCCTCATGG - Intergenic
947012482 2:225582113-225582135 CAGCCCCGCGGGAGACCCCGAGG + Exonic
947535194 2:230935646-230935668 CAGCCCAGTCCCAGAGCCCAGGG - Intronic
947800864 2:232927996-232928018 CCGCCCCGCCGCCGACCCTATGG - Intronic
948222141 2:236279028-236279050 CAGCCCAGAGCCAGTCCCCATGG - Intergenic
948852071 2:240713384-240713406 GGGCCCAGGCGCAGACCCCATGG + Intergenic
1169358752 20:4929475-4929497 CAGTCCAGAGGCAGACCCTAGGG - Intronic
1171143833 20:22764911-22764933 CAGCCCCTAAACAGAGCCCAGGG - Intergenic
1171475838 20:25407938-25407960 CCGCCCCGCCCCAGAGCCCAGGG - Intronic
1172118778 20:32585674-32585696 CAGCCCAGACGCCGACCTCCCGG + Intronic
1173200108 20:40948261-40948283 GAGTCCTGAAGCAGACCCCAAGG + Intergenic
1174039351 20:47688052-47688074 CATCCACCCCGCAGACCCCAGGG - Intronic
1174303055 20:49595979-49596001 CAGCACCCACGCAGTCTCCAAGG - Intergenic
1175278138 20:57785862-57785884 CAAGCCCTACGCAGAGCCCAGGG - Intergenic
1175414480 20:58792736-58792758 CAGCCCCGAAGCTGGCCCCGGGG - Intergenic
1175879557 20:62249279-62249301 CAGCACAGACTCAGGCCCCAGGG + Intronic
1176000468 20:62829249-62829271 GAGCCCCTACTCAGAGCCCATGG - Intronic
1176048417 20:63104187-63104209 CAGCCCCGTCCCTGATCCCAGGG - Intergenic
1179304803 21:40144421-40144443 GAGCCCCGGGGCAGACCCGAGGG + Intronic
1181265861 22:21630095-21630117 CCGCCCCGACGCACACGCCCAGG + Intergenic
1183210679 22:36449465-36449487 CAGCCACGACGCAGGCCCCCTGG + Intergenic
1184066961 22:42126632-42126654 CAGCCCCGGCCCAGCCACCATGG - Exonic
949271445 3:2222661-2222683 CACCCCCAACACACACCCCAGGG + Intronic
950018408 3:9769782-9769804 CCGCCCCCACGCAGCGCCCAGGG + Intronic
950443510 3:13023240-13023262 CAGCCTGGGCCCAGACCCCAAGG - Intronic
951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG + Intronic
952269504 3:31817596-31817618 CAGCCCCGTCTAAGACCACAGGG + Intronic
962966992 3:140364640-140364662 AAGCCCCTTCCCAGACCCCAGGG - Intronic
963318537 3:143786895-143786917 CAGCCCAGACGTAGGCTCCAGGG + Intronic
965632443 3:170747085-170747107 CATGCCCTACGTAGACCCCAGGG - Intronic
967906743 3:194507762-194507784 CAGCCAGGACGCAGGCCCTAAGG - Intergenic
967970959 3:194999191-194999213 CAGCCCCGACCCAGCCCCAGGGG + Intergenic
968573399 4:1353986-1354008 CAGCCTCCACTCACACCCCAGGG - Intronic
968574037 4:1356721-1356743 CAGCCCCCACGCAGCCCACTAGG - Intronic
968691263 4:1991658-1991680 CAGCCTCGACTCGGACCCCTGGG - Exonic
968849598 4:3069920-3069942 AAACCCTGACGCAGACCCCAGGG - Intergenic
969964614 4:10981352-10981374 CGGTCCCGATTCAGACCCCAAGG + Intergenic
973386913 4:49519139-49519161 CTGTCCCGAGGCATACCCCAGGG + Intergenic
983532158 4:168822079-168822101 CAGCCCCTCCGCAGAACACATGG + Intronic
985334108 4:188873070-188873092 GAGCCAGGACGCAGACACCAGGG - Intergenic
985717388 5:1470293-1470315 CAGACCCCACTCAGCCCCCAGGG + Intronic
985753944 5:1701969-1701991 CGGCCCAGTCACAGACCCCATGG - Intergenic
986786452 5:11118670-11118692 CAGCCATGAGGCAGATCCCAAGG + Intronic
992509198 5:77416635-77416657 CATTCCCAACGCTGACCCCATGG - Intronic
993470600 5:88302883-88302905 CAGCACCGTGGTAGACCCCAAGG - Intergenic
997702091 5:135909669-135909691 CAGGCACCACGCACACCCCAGGG + Intergenic
999116716 5:149170499-149170521 CAGGCCCCACCCAAACCCCATGG + Intronic
999476010 5:151899554-151899576 CATCCCCGGCTCTGACCCCAAGG + Intronic
1001415750 5:171543925-171543947 CAGCCCAGGCGAAGACCTCAGGG + Intergenic
1001529812 5:172454136-172454158 CAGCGCCGCCGCAGAGCCGAGGG + Intronic
1001695776 5:173668614-173668636 CAGCCCTGTCTCAGAGCCCAGGG - Intergenic
1001738367 5:174026863-174026885 CAACCCCAATGCAAACCCCATGG - Intergenic
1007519923 6:42444082-42444104 CACCTCCCATGCAGACCCCATGG + Intronic
1018751129 6:166807535-166807557 CGGCTCCCACTCAGACCCCAGGG + Intronic
1018949589 6:168370567-168370589 CAGCCTGGACGCAGACCCAGAGG - Intergenic
1022778318 7:33551559-33551581 CAGCCAAGACTGAGACCCCAAGG + Intronic
1024357364 7:48427812-48427834 CAGCTCTGACTCAGTCCCCAGGG - Exonic
1032979199 7:137262703-137262725 CAGCCCCGTCACATACCCCCTGG - Intronic
1035469006 7:159097969-159097991 CAGCCCCCACACAGACCCACTGG + Intronic
1035814050 8:2519706-2519728 CAGCGTCGACACAGACCACAAGG - Intergenic
1036651394 8:10646334-10646356 CAACCCAGAAGCAGACACCAGGG + Intronic
1049457501 8:142700972-142700994 CAGGCCCAACCCAGACCCAAGGG + Intronic
1049572656 8:143376474-143376496 CAGCCCCAAGGCAGAGCCAAAGG - Intronic
1049686297 8:143940549-143940571 CAGCTCCGCCCCGGACCCCAGGG - Intronic
1049757511 8:144317302-144317324 CAGCCCCCAGGGACACCCCAGGG + Intronic
1050276724 9:4008465-4008487 CAGCCCCTACTAAGACCCCTAGG + Intronic
1053577155 9:39364499-39364521 CAGCCTCCACAGAGACCCCACGG + Intergenic
1053841657 9:42192424-42192446 CAGCCTCCACAGAGACCCCACGG + Intergenic
1053850876 9:42288462-42288484 CAGCCCCTCCCCAGACACCAAGG + Intergenic
1054098726 9:60923189-60923211 CAGCCTCCACAGAGACCCCACGG + Intergenic
1054120126 9:61198818-61198840 CAGCCTCCACAGAGACCCCACGG + Intergenic
1056930765 9:90874715-90874737 GAGCCCCTACGCGGACCCCGAGG + Exonic
1059224921 9:112663109-112663131 CAGCCTTGACACAGAGCCCAGGG - Exonic
1060757175 9:126222623-126222645 CAGCCCCACCCTAGACCCCAGGG + Intergenic
1061231819 9:129319895-129319917 CTCCCCCGACGCCGGCCCCAGGG + Intergenic
1061672004 9:132194131-132194153 CAGCCCCTAGGAAGTCCCCAGGG + Intronic
1062306244 9:135908234-135908256 GGGCCCCGACGCAGGCTCCAGGG - Intergenic
1062418341 9:136465652-136465674 CATCCCCATCGCAGACCCCGTGG - Intronic
1062589526 9:137267144-137267166 CAGCCCTGAGGCAGCCCCCTGGG - Intronic
1200086846 X:153611315-153611337 CAGCCCAGACTCACATCCCATGG + Intergenic
1200701270 Y:6404592-6404614 CAGCCCCCACGTTGACACCATGG + Intergenic
1201032842 Y:9760106-9760128 CAGCCCCCACGTTGACACCATGG - Intergenic