ID: 1076798939

View in Genome Browser
Species Human (GRCh38)
Location 10:132811833-132811855
Sequence CCAGGGCCTGCACTTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2276
Summary {0: 1, 1: 0, 2: 4, 3: 115, 4: 2156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076798939_1076798948 -6 Left 1076798939 10:132811833-132811855 CCCCACCCAAGTGCAGGCCCTGG 0: 1
1: 0
2: 4
3: 115
4: 2156
Right 1076798948 10:132811850-132811872 CCCTGGGTGCCAGGTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076798939 Original CRISPR CCAGGGCCTGCACTTGGGTG GGG (reversed) Intronic
Too many off-targets to display for this crispr