ID: 1076798976

View in Genome Browser
Species Human (GRCh38)
Location 10:132811968-132811990
Sequence GCTGATGGCCCCACTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076798976_1076798980 -6 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798980 10:132811985-132812007 ATCAGCAGCCCCATCAGAGAAGG No data
1076798976_1076798989 24 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798989 10:132812015-132812037 AAGTGGGCTGGCCCTGCACAGGG No data
1076798976_1076798988 23 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798988 10:132812014-132812036 CAAGTGGGCTGGCCCTGCACAGG No data
1076798976_1076798990 25 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798990 10:132812016-132812038 AGTGGGCTGGCCCTGCACAGGGG No data
1076798976_1076798986 8 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798986 10:132811999-132812021 CAGAGAAGGTCACGGCAAGTGGG No data
1076798976_1076798987 12 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798987 10:132812003-132812025 GAAGGTCACGGCAAGTGGGCTGG No data
1076798976_1076798985 7 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798985 10:132811998-132812020 TCAGAGAAGGTCACGGCAAGTGG No data
1076798976_1076798991 26 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798991 10:132812017-132812039 GTGGGCTGGCCCTGCACAGGGGG No data
1076798976_1076798981 0 Left 1076798976 10:132811968-132811990 CCCCACACAGTGGGGCCATCAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1076798981 10:132811991-132812013 AGCCCCATCAGAGAAGGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076798976 Original CRISPR GCTGATGGCCCCACTGTGTG GGG (reversed) Intronic
900489276 1:2938810-2938832 TCTGGGGCCCCCACTGTGTGGGG + Intergenic
900950426 1:5855482-5855504 GCTGATGGCCCAACAGAGGGAGG + Intergenic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901626020 1:10625554-10625576 GCAGGTGGCACCTCTGTGTGTGG - Intronic
902942920 1:19813595-19813617 GCAGCTGGCCCCACTGTATGTGG + Intergenic
904034515 1:27551588-27551610 GCTGTTGGCCAAACTGGGTGAGG + Exonic
904168580 1:28574994-28575016 GCTGAGGGTCACACAGTGTGGGG + Intronic
904498028 1:30898453-30898475 ACTGATGGACCCTCTGTGTCTGG - Intronic
905347168 1:37319047-37319069 GCTGAGGGCCCAAGTGTGTGTGG + Intergenic
905791050 1:40789778-40789800 GCTGATGGCAGCACTTTGAGTGG + Intronic
910044583 1:82896920-82896942 GCAGATGGCCATACTGTGAGAGG + Intergenic
911602819 1:99865578-99865600 GCTGATGGCCACGCTTTGTCAGG - Intronic
914521070 1:148416929-148416951 ACTGATGGCCCTCCTGTGTCAGG - Intergenic
914742090 1:150473150-150473172 GCTGATGGTGTCTCTGTGTGAGG - Exonic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915280377 1:154818376-154818398 GCTGCTGGCCCCCCTGGGAGAGG - Intronic
917034215 1:170729286-170729308 GCTGAAGTCCACACTCTGTGGGG + Intronic
918074364 1:181159289-181159311 ACTGATAGCCCCAGGGTGTGGGG - Intergenic
918111107 1:181456173-181456195 GCTGATGGTACCAGTGAGTGAGG + Intronic
922422851 1:225471216-225471238 GCTCAGAGCCCCACTGTGGGAGG + Intergenic
922764905 1:228151664-228151686 GCAGTAGGCCCCACTGGGTGTGG - Intronic
922880943 1:228980175-228980197 GCTGAAGGGCCCATAGTGTGTGG - Intergenic
923565510 1:235073372-235073394 GCCGTGGGCCCCACTGTCTGAGG - Intergenic
924798780 1:247311855-247311877 GCTGATGGCCCCACCATCTAGGG + Intronic
1069859094 10:71459348-71459370 GCTCATGCCCCCACTTTGGGAGG - Intronic
1071461345 10:85899763-85899785 GCTGAAAAGCCCACTGTGTGAGG - Intronic
1071499409 10:86192900-86192922 GCCTAAGGCTCCACTGTGTGTGG + Intronic
1073329495 10:102661216-102661238 GCTGTCGGCCCCAGTCTGTGGGG - Intergenic
1074858237 10:117489353-117489375 GCTGATGGCAGCACTGAGTCTGG - Intergenic
1075211025 10:120491123-120491145 GCTGCTGGCCCTGCTGGGTGAGG + Intronic
1075685978 10:124365409-124365431 TCTGTTGGCCCCACTGCGGGTGG - Intergenic
1076582370 10:131520294-131520316 GTTGATGGCAGCAGTGTGTGGGG + Intergenic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1077213016 11:1382251-1382273 GCTAATGTCCCCACTGTGACAGG + Intergenic
1077231511 11:1459962-1459984 GCTGCTGGCCCCACTGCATGAGG - Intronic
1077295823 11:1825810-1825832 CGTGCAGGCCCCACTGTGTGCGG - Intergenic
1077410128 11:2400033-2400055 GCTGAGGGCCCAAGGGTGTGAGG + Intergenic
1078822426 11:14895189-14895211 GCTGATTGCATCACTCTGTGTGG - Intergenic
1080033819 11:27689888-27689910 GCTCCAGGCCCCAGTGTGTGTGG + Intronic
1083897828 11:65629020-65629042 GCTGTGGGCCCCTCTGTGGGTGG - Intronic
1084184224 11:67463207-67463229 CCTGAAGGCCCCGCTGTGTTGGG + Exonic
1085985711 11:81785232-81785254 GCTCATAGGCCCACTGTATGAGG - Intergenic
1090007835 11:123018520-123018542 TGAGATGGCCCCAGTGTGTGCGG + Intergenic
1090406895 11:126481551-126481573 GAGAATGGCCCCACTGTTTGGGG + Intronic
1091371617 11:135065050-135065072 GTTTATTGCCCAACTGTGTGGGG + Intergenic
1091711278 12:2742281-2742303 GGAAATGCCCCCACTGTGTGGGG - Intergenic
1091917369 12:4279452-4279474 GCTGTTTGCCCCACTGGGCGCGG + Intronic
1094455837 12:30631955-30631977 GCTGATGGCACCACTCAGCGAGG - Exonic
1101095038 12:101329745-101329767 GCTGATGCCACCACTTTGGGAGG + Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1103833337 12:123798367-123798389 GCTCCTGCTCCCACTGTGTGAGG - Intronic
1104248100 12:127062165-127062187 GCTGACATCCCCACTGTGTAAGG - Intergenic
1108714301 13:53063808-53063830 GCTGATGCCCTCTCTGTGTCCGG + Intergenic
1113272761 13:108692853-108692875 GCTGATGTCCACACTGTGGATGG + Intronic
1113467249 13:110520937-110520959 GCAGATTTCCCCACTGGGTGTGG - Intergenic
1114219350 14:20682991-20683013 GCTGTTGGCCTCACTGGGCGCGG - Intergenic
1117174177 14:53130730-53130752 GCTGTTGTCCCATCTGTGTGGGG + Intronic
1118866094 14:69704820-69704842 GCTGGTGGCCCCAATCTCTGTGG + Intronic
1121019711 14:90572396-90572418 GGAGATGGCCCCACGATGTGAGG - Intronic
1121431640 14:93892172-93892194 GCTGTTAGCCCCGGTGTGTGAGG + Intergenic
1122896762 14:104761553-104761575 ACTGATGGCTCCTGTGTGTGAGG + Intronic
1125815605 15:42581414-42581436 GCTGATGGCCACGGTGTGGGTGG + Intronic
1128056388 15:64702923-64702945 GCGGATGGCCCCGCTGCGGGGGG + Intronic
1132554729 16:567461-567483 GAATAAGGCCCCACTGTGTGTGG - Exonic
1132657357 16:1046851-1046873 GCTCAGAGCCCCACTGTGTGAGG + Intergenic
1133602873 16:7356978-7357000 GCTGAGGGCCCCTCTGTGCTTGG + Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134678419 16:16106755-16106777 GCTGATGTCCCCACTATAGGAGG - Exonic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135359058 16:21795898-21795920 GTGAATGGCCCCAGTGTGTGGGG - Intergenic
1135457610 16:22612335-22612357 GTGAATGGCCCCAGTGTGTGGGG - Intergenic
1136284150 16:29231445-29231467 GCAGCAGGCCCCAGTGTGTGTGG + Intergenic
1137585143 16:49659806-49659828 GCTGACGGCACCCCTGTGGGTGG + Intronic
1139589867 16:67927683-67927705 CCAGATGGCACCACAGTGTGTGG - Exonic
1140851979 16:78943601-78943623 GGCGATGGCTCCACTCTGTGTGG + Intronic
1142089185 16:88200954-88200976 GCAGCAGGCCCCACTGTGTGTGG + Intergenic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143630880 17:8139766-8139788 GCTGAAGGGCCCTCTCTGTGTGG + Intergenic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147997868 17:44370997-44371019 GCTGAAGGCCCCTCTTGGTGGGG + Intergenic
1148746341 17:49920338-49920360 GCTGATGGCACCCCTGTCTGGGG + Intergenic
1149576181 17:57715286-57715308 CCTGGTGGCCCCTCTCTGTGTGG - Intergenic
1150347729 17:64417269-64417291 GCTGAAGCCTCCACTGTATGGGG - Intergenic
1151657782 17:75503764-75503786 CCTGATGGCCAGACTTTGTGTGG - Intronic
1152901299 17:82942539-82942561 GCTGGAGGCACCACTGTGCGAGG - Exonic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1155369092 18:25079144-25079166 GCAGATGGCGCCAGTGCGTGGGG + Intronic
1156482762 18:37446395-37446417 GCTGTTGGGCTCCCTGTGTGAGG + Intronic
1156675701 18:39524948-39524970 GCTGATGGCACCACAGGGAGGGG - Intergenic
1158964093 18:62608587-62608609 GATGATGGTCCCACATTGTGAGG - Intergenic
1160979065 19:1808107-1808129 GCTGAGGGTCCCAGTCTGTGGGG + Intronic
1161237255 19:3204251-3204273 TCTGAGGGCCACACTGTGTCGGG + Intronic
1161679038 19:5669842-5669864 GATGATGCCCACACTGTGGGTGG - Intergenic
1163374802 19:16923419-16923441 TCTGAGGGCACCACTGTGTGTGG + Intronic
1163699693 19:18781100-18781122 GCCGAGGGGCCCTCTGTGTGGGG + Exonic
1164160752 19:22624055-22624077 GGTGATGGCCTCCCTGTGTGTGG - Intergenic
1165114582 19:33521484-33521506 TCTGGCGGCCCCACCGTGTGCGG - Intronic
1166887328 19:45970040-45970062 GCGGCTGGCTCCATTGTGTGGGG - Intronic
1167068283 19:47203683-47203705 CGAGATGGCCCCAGTGTGTGCGG + Exonic
926696076 2:15770960-15770982 GCTGATGGCCTCACTATTTCGGG - Intergenic
929579610 2:43073491-43073513 GCTGATGGCCAAATTGTGTCTGG + Intergenic
936405142 2:112196058-112196080 GCCAATGGCCCCACTCAGTGTGG + Intergenic
936643668 2:114344739-114344761 GCAGAAGGGCCCACTGTATGAGG - Intergenic
937333386 2:121045736-121045758 GCTCAGGGCCCCACTGCATGGGG + Intergenic
938901337 2:135800882-135800904 GCAGATGTCCCCTCTGTGTTTGG + Intronic
940859589 2:158758123-158758145 GCTGAGGGCCCCACGCTCTGAGG - Intergenic
941625024 2:167822023-167822045 GCTGCTTCCTCCACTGTGTGGGG - Intergenic
941844623 2:170120797-170120819 GCTGCTGGCCCCACAGAGTGTGG - Intergenic
944724769 2:202459502-202459524 TTTGCTGGCCCCAGTGTGTGGGG + Intronic
946827327 2:223692183-223692205 GCTACTGGCCCCGCTCTGTGGGG - Intergenic
948231843 2:236354803-236354825 CCTGATGCCCTCCCTGTGTGGGG + Intronic
948779738 2:240311416-240311438 TGCGATGGCCCCAGTGTGTGAGG - Intergenic
1169050409 20:2572257-2572279 GCTGATGGCCAAGGTGTGTGGGG + Exonic
1169308044 20:4510712-4510734 CCATATGGCCCCACTGAGTGAGG + Intergenic
1169745138 20:8935712-8935734 GCTGATGGCCCACCTGTGGATGG - Intronic
1170644993 20:18189948-18189970 CTTGATGGCCCCTGTGTGTGGGG + Intergenic
1170712812 20:18807650-18807672 GCTGTAGGCACCACTGTGTTGGG - Intergenic
1171938531 20:31300916-31300938 ACTGAGGACCCCACTCTGTGGGG + Intergenic
1173483603 20:43423470-43423492 GCTGATGGGCACAGTGTGGGTGG + Intergenic
1173644595 20:44625672-44625694 GGTGAGGTCCCCTCTGTGTGAGG + Exonic
1174274894 20:49396563-49396585 GCTGATGGCTCAGATGTGTGGGG + Intronic
1175409648 20:58758472-58758494 GCTGCAGTCCCCACTGTGTAAGG + Intergenic
1176308051 21:5134674-5134696 GCTCCTGGCTCCTCTGTGTGGGG + Intronic
1178499838 21:33116663-33116685 GCAGATTTCCCCACTGAGTGAGG + Intergenic
1179849009 21:44127358-44127380 GCTCCTGGCTCCTCTGTGTGGGG - Intronic
1180988558 22:19919910-19919932 GCTGATGCCAGCACTGTGAGGGG - Intronic
1181829222 22:25546088-25546110 GCTGCTGGCCCCTCTGTGTCTGG + Intergenic
1183318112 22:37148035-37148057 GCAGAGAGCCCCAGTGTGTGAGG + Intronic
1184340631 22:43884072-43884094 GCTGGTGTCCCCACACTGTGTGG - Intronic
1185069070 22:48646502-48646524 GCTGGGGGCCCCTCTGTGGGTGG + Intronic
954447446 3:50554243-50554265 CATGATTGCCTCACTGTGTGGGG - Intergenic
954761166 3:52875461-52875483 TGTGATGGGGCCACTGTGTGAGG - Intronic
954932260 3:54294479-54294501 GCTGCTGGAGCCACTGTGGGAGG + Intronic
957634103 3:82759533-82759555 GATGTTGCCCCCACTGTGGGTGG - Intergenic
958122705 3:89312748-89312770 CCAGAAGGCCCCAGTGTGTGTGG + Intronic
961471085 3:127113310-127113332 GCTGATGGGCTCTGTGTGTGGGG + Intergenic
966958397 3:184908591-184908613 GCCTCTGGCCCCATTGTGTGGGG + Intronic
967955855 3:194876787-194876809 CCTGATGGCCCCACGGTGGTCGG + Intergenic
969866660 4:10080755-10080777 GCAGGTGGCCCCACTGTCTGGGG + Intronic
973572039 4:52250510-52250532 TCTTAAGGCCCCACTCTGTGTGG + Intergenic
977651651 4:99476871-99476893 GCTGATGGCCAGAATCTGTGAGG + Intergenic
979809417 4:125017037-125017059 GCTGTTGGCCCCAGTGCATGCGG + Intergenic
981176388 4:141688827-141688849 ACTAGTGGCCCCACTGTGTCCGG + Intronic
983655938 4:170084645-170084667 GATAATGGCCCTACTGTTTGTGG - Intronic
985871726 5:2562760-2562782 GCAGATGGTCCCCCTTTGTGAGG - Intergenic
989332959 5:40281349-40281371 CCTGATGGCTGCACTGTGGGAGG - Intergenic
991030589 5:62078196-62078218 GCTGCTGGCACCACTGAGTGGGG - Intergenic
994722948 5:103401598-103401620 GCTTCTGTCCCCACTGAGTGAGG - Intergenic
997505813 5:134415858-134415880 GATGAGGGTCTCACTGTGTGTGG - Intergenic
1003243535 6:4365187-4365209 GCTGATGGCGCCTGTGGGTGGGG + Intergenic
1004405441 6:15328882-15328904 GCTGAGGCCCCACCTGTGTGGGG + Intronic
1006639658 6:35483410-35483432 AGTGATGGCCCCACTGCCTGGGG - Intronic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1012500177 6:99879679-99879701 CCTGTTGGCCCCTCTGTGAGAGG - Intergenic
1017034923 6:150258431-150258453 GCTGATGGCCCCATTACTTGCGG - Intergenic
1017765389 6:157603021-157603043 GACGATGGCCCCACGGTCTGGGG - Intronic
1019115223 6:169755314-169755336 GCTGCTGGGCCCTGTGTGTGAGG + Exonic
1019210075 6:170397803-170397825 GCTGTTGGCCCCTCTAGGTGAGG + Intronic
1019623460 7:2003622-2003644 TCCGGTGGCCCCACTGAGTGAGG - Intronic
1022297364 7:29068606-29068628 GCAGATGCCTCCATTGTGTGAGG - Intronic
1022675531 7:32495636-32495658 TCTGACGACCCCACCGTGTGCGG - Exonic
1025021909 7:55486896-55486918 GCAGATGGACCCAGGGTGTGTGG - Intronic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1030311797 7:108076316-108076338 GCCCATTGCCCCACTCTGTGGGG + Intronic
1030583657 7:111390235-111390257 TCTGAAGGCCACACTGTCTGAGG + Intronic
1033789932 7:144779289-144779311 CCTGATAGCACCACTTTGTGAGG - Intronic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1035635770 8:1143067-1143089 GCTGGTGGCCCCGCTGTGGCCGG - Intergenic
1036563144 8:9914355-9914377 GGTCTTGACCCCACTGTGTGTGG + Intergenic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1036982873 8:13490490-13490512 CCTGTTGGCACCACTGTGTCTGG + Intronic
1039465739 8:37784016-37784038 CCTGATGGCTTCAATGTGTGGGG + Intergenic
1039777402 8:40750745-40750767 TCTGATGGCCCACCTGGGTGTGG - Intronic
1045906569 8:107353327-107353349 GGTCATGGCCCCTCTGTGTGTGG + Intronic
1047379879 8:124350699-124350721 TCTGAAGGTTCCACTGTGTGTGG + Intronic
1048042165 8:130741478-130741500 GCTTCTGGCCCCACTGAATGTGG - Intergenic
1049108405 8:140627907-140627929 GCTGCTGCCCCCACTGTCTCGGG + Intronic
1049206521 8:141366193-141366215 GCTGATGGGCCCACACCGTGTGG + Intronic
1049302302 8:141878051-141878073 GCTGATGGGCCATCTCTGTGTGG - Intergenic
1049546480 8:143234020-143234042 CCTCATGGCCCCAGGGTGTGAGG - Intergenic
1054769213 9:69068553-69068575 GCTGCTGGCCCTCCTGTGGGCGG + Intronic
1054781895 9:69173821-69173843 GCTGCTGGCCCGACTGTCCGCGG - Intronic
1056710141 9:88985827-88985849 GCAGGTGGCCCCATTGAGTGTGG - Intergenic
1056988520 9:91387938-91387960 GCTGTTATCCCCACTGTGTCTGG + Intergenic
1061390249 9:130313675-130313697 GCTGGTTGCCTGACTGTGTGTGG + Intronic
1061471566 9:130830845-130830867 GCCCATGGCCCCACAGTGAGTGG + Intronic
1062323203 9:136000632-136000654 CCTTATGGCCTCACTCTGTGTGG + Intergenic
1062683786 9:137799470-137799492 GCAGGTGGCCCCTGTGTGTGAGG - Intronic
1062690279 9:137837963-137837985 GCACAAGGACCCACTGTGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1192425223 X:71068858-71068880 GCTGAGTGCGCCATTGTGTGTGG - Intronic
1197729710 X:129799135-129799157 TCTCATGGCCCAACTGTGGGCGG - Intergenic
1198741626 X:139849123-139849145 GCTGATGTGCACACAGTGTGAGG - Intronic