ID: 1076800144

View in Genome Browser
Species Human (GRCh38)
Location 10:132817964-132817986
Sequence GAGAAGCAGGAGAAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1483
Summary {0: 1, 1: 1, 2: 8, 3: 167, 4: 1306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076800144_1076800152 23 Left 1076800144 10:132817964-132817986 CCAGGCTCCTTCTCCTGCTTCTC 0: 1
1: 1
2: 8
3: 167
4: 1306
Right 1076800152 10:132818010-132818032 CTGGGCCCACCCAGATCCCCAGG No data
1076800144_1076800149 4 Left 1076800144 10:132817964-132817986 CCAGGCTCCTTCTCCTGCTTCTC 0: 1
1: 1
2: 8
3: 167
4: 1306
Right 1076800149 10:132817991-132818013 GTGAGGGCTTTCTCATCACCTGG No data
1076800144_1076800150 5 Left 1076800144 10:132817964-132817986 CCAGGCTCCTTCTCCTGCTTCTC 0: 1
1: 1
2: 8
3: 167
4: 1306
Right 1076800150 10:132817992-132818014 TGAGGGCTTTCTCATCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076800144 Original CRISPR GAGAAGCAGGAGAAGGAGCC TGG (reversed) Intronic
900400440 1:2470841-2470863 GAGGAGCTGCAGAGGGAGCCAGG - Intronic
900581571 1:3412325-3412347 GGGATGCAGGAGAAGAAGCTGGG + Exonic
900637528 1:3673240-3673262 GAGAGGCACTCGAAGGAGCCAGG + Intronic
900724166 1:4204189-4204211 GAGTAGCAGGAGATGGGGACAGG + Intergenic
900923068 1:5685877-5685899 GAAAGGCAAGAGAAGGAACCTGG + Intergenic
901141599 1:7037347-7037369 GAGAGGCAGGCGGAGGAGCAGGG + Intronic
901226676 1:7617098-7617120 GGGAGCCAAGAGAAGGAGCCAGG + Intronic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901629750 1:10642296-10642318 GAGGAGGAGGAGGAGGAGCCGGG + Intronic
901749345 1:11396385-11396407 GAGAAAGAGGAGAGGGAGCTGGG + Intergenic
901751693 1:11413915-11413937 GAGAAGGGGGAGAAGGAGGGAGG - Intergenic
901786804 1:11630125-11630147 GGGAAGCAGGACAAGGGGCAGGG - Intergenic
901878132 1:12178731-12178753 GAGAAGGGGGCGGAGGAGCCAGG + Intronic
902541523 1:17158969-17158991 GGGAAGCAGCAGAGAGAGCCAGG - Intergenic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902911039 1:19597295-19597317 GAGGAGCCGGAGCAGCAGCCCGG + Intronic
902959770 1:19954924-19954946 GGGAAGGAAGAGAAGAAGCCAGG - Intergenic
902961569 1:19967053-19967075 GAGAAGGAGGAGGAGGAAACAGG - Intergenic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903337226 1:22633269-22633291 GAGGAGGAGGAGGAGGAGACTGG + Intergenic
903547881 1:24138117-24138139 GAGGAGCAGGAACAGGAGCGTGG + Intronic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903595360 1:24490008-24490030 GAGAAGCACGGGCAGGAGTCAGG + Intergenic
903679103 1:25085184-25085206 GAAAAGCAGGAGCAGAATCCAGG - Intergenic
903680462 1:25093040-25093062 CAGAAGCAGATGAGGGAGCCTGG + Intergenic
903846809 1:26283770-26283792 GAGAAGCAGAATAGGGAGCGAGG + Intronic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904456336 1:30650403-30650425 GAGAGGCATCAGATGGAGCCAGG - Intergenic
904611723 1:31729483-31729505 TAAAGGCAGGAGAAGGTGCCGGG - Intronic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904644810 1:31957743-31957765 GAGAAGGAGGAGAAGAACCGGGG - Intergenic
904773188 1:32892497-32892519 GGGAAGCAGCAGCAGGAGCTGGG + Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905183485 1:36180154-36180176 GTGGAGCAGGAGAGGGTGCCTGG - Intronic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905309719 1:37041036-37041058 GACACTCAGGAGGAGGAGCCAGG + Intergenic
905595711 1:39204863-39204885 GAGATGGAGGAGAAGCTGCCAGG + Intronic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
905858381 1:41330054-41330076 AACAAGCTGGAGAAGGGGCCTGG - Intergenic
905980561 1:42222001-42222023 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
905986753 1:42291999-42292021 GAAAGGCAGGAGTGGGAGCCAGG + Intronic
905998856 1:42405932-42405954 GAGGAGCAGAGAAAGGAGCCTGG + Intronic
906066510 1:42984849-42984871 GGGAAGAAGGAGGAGGAGCGGGG + Intergenic
906109183 1:43312075-43312097 GGGAAGGAGGAGAGGGGGCCTGG + Exonic
906141881 1:43538678-43538700 GAGAAGCAGAAGAAAGATCCTGG - Intronic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906261445 1:44394456-44394478 GAGAAGTCGGTGAAGGAGACTGG - Intergenic
906670862 1:47653636-47653658 GAGAAGCTTGAGAGGGAGCACGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907858495 1:58327318-58327340 GAGAAGGAAGAGGAGGAGGCAGG + Intronic
908246814 1:62233913-62233935 GAGGAGCAGGAGAACGTTCCAGG - Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908889292 1:68825293-68825315 GAGAATCAGTACTAGGAGCCAGG + Intergenic
909428295 1:75553898-75553920 GAGGAGGAGGAGGAGGAGCTAGG + Intronic
909647189 1:77931090-77931112 TAGAAGCGGTAGAAGAAGCCGGG + Intronic
909957841 1:81801332-81801354 GGGAAGGAGGAGGAGGAGGCTGG + Intronic
910009222 1:82439876-82439898 AAGAAGTATGAGAAGGAGCAGGG + Intergenic
910033321 1:82759024-82759046 GAGAAACAGGAGGAGGAAGCAGG - Intergenic
910163227 1:84296592-84296614 GAGGAGCAGGAGAGGGAGAGAGG + Intergenic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910368335 1:86489595-86489617 AAGAAACAGGAGAAGTAGCAGGG + Intronic
910636011 1:89408737-89408759 GAGGAGGAGGAGAAGGGGCTGGG - Intergenic
911227110 1:95318526-95318548 GAGAAGCAGGTGAAGTAGGGAGG - Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
912186957 1:107289043-107289065 GAGAAGCTGGAGGAGGAGTTAGG - Intronic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912587361 1:110779243-110779265 GAGTAGCAAGAGAAGAAGCAAGG + Intergenic
912600486 1:110927569-110927591 GAGAAGCTGAAGAAAGATCCAGG + Intergenic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913300855 1:117367341-117367363 GAGGAGGAGGAGGAGGAGCTCGG + Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913557710 1:119985076-119985098 TAGATGCATGAGAAGGAGACTGG + Intronic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914755365 1:150559044-150559066 GGGAAGCAGGAGCAGGAACTGGG + Exonic
914833509 1:151188674-151188696 GAAAAGCAGGAGAAGGAGAAAGG - Intronic
914913185 1:151802639-151802661 GAGGAGGAGGAAAAGGAGCGGGG + Exonic
914918311 1:151831547-151831569 GAGAAACAGGAGGAGGGGCTGGG - Intronic
915143263 1:153779672-153779694 GACAGGGAGGAGAAAGAGCCAGG - Intronic
915237684 1:154497156-154497178 GAGAAGCAGGAAGCGGAGCCAGG + Intronic
915635659 1:157184751-157184773 GGGATGCAGGTGAAGGAACCTGG + Intergenic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915942012 1:160124230-160124252 GACCAGCAGGAGAAGAAGGCAGG + Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916918762 1:169439527-169439549 GACAGGCAGGTGCAGGAGCCAGG + Intronic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917087532 1:171318919-171318941 GACAGGCAGGTGCAGGAGCCAGG + Intronic
917216275 1:172681307-172681329 GAGAAGGAGAAGAAGGAGGTTGG + Intergenic
917803567 1:178593467-178593489 GAGAAGCAGAAGGAGGAAACAGG - Intergenic
918105967 1:181415489-181415511 GAGAAGGAGTAGAAGGAGGTGGG + Intronic
918315892 1:183322509-183322531 GAGGAGCAGGAGTAGGAGTGGGG - Intronic
918448930 1:184640812-184640834 GTGAGGCAGAAGGAGGAGCCAGG - Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920091599 1:203456892-203456914 GAGAAGCAAGAGAGGAAGCGGGG + Intergenic
920092152 1:203462392-203462414 GAGAAGCTGGAGAACCAGGCTGG - Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920371120 1:205479971-205479993 GAGGGGCAGGAGAAGAAGCCAGG + Intergenic
920543077 1:206793898-206793920 GAGTAGCAGGGGAAGGAGAGTGG + Intergenic
920669010 1:207988799-207988821 GAGAAGGAGGAGAAGATGGCGGG - Intergenic
920968452 1:210721648-210721670 CAGAAGCCGTAGAAGGAGCGGGG + Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922174113 1:223181703-223181725 GAGAAGGAGGTGAACCAGCCGGG + Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922476282 1:225908902-225908924 GAGAAGCAGGTGTGGAAGCCAGG - Intronic
922673503 1:227532900-227532922 AAGAAGCAGCAGAAAGATCCTGG - Intergenic
922731480 1:227950670-227950692 GAGAAGCAGGAGGTGGGGGCAGG - Intergenic
922766289 1:228158215-228158237 GAGGAGGAGGAGGAGGAGACGGG + Exonic
922902244 1:229146228-229146250 GAAGTGCAGGAGAAGGAGGCAGG + Intergenic
923016514 1:230130637-230130659 GAGCAGAAGGACAAGCAGCCCGG + Intronic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923209941 1:231794725-231794747 GAGAAGCAGGAGAAGGCTAAGGG + Intronic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
924061752 1:240182235-240182257 GAGAACCTGGAGCAGGAGCAAGG + Intronic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924455470 1:244215562-244215584 GAGGCGGAGGAGGAGGAGCCGGG + Intergenic
924539642 1:244969887-244969909 GGGAAGCGGGAGGAGGAGGCCGG + Exonic
924593670 1:245427001-245427023 GAGAAGGATGGGAAGGAGCGTGG + Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924817681 1:247457026-247457048 GAAGAGGAGGAGAAGGAGCTGGG + Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063495220 10:6501467-6501489 GAGGAGCAGGAGGAGAAGGCGGG + Intronic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064142355 10:12801111-12801133 GAGAAGGAGGAGATGGAGTTGGG + Intronic
1064303205 10:14141093-14141115 GAGAAGCAGGAGATGGAGAATGG + Intronic
1064407155 10:15074241-15074263 GAAAAGCAGAAATAGGAGCCAGG + Intergenic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064978941 10:21147222-21147244 GAGAGGCAGGAGGAGGTCCCAGG - Intronic
1065019692 10:21494362-21494384 GAGAAGCCTGGGAAGGAGCTTGG + Exonic
1065169295 10:23010807-23010829 GAGAGGCAAGGGAAGGAGCAGGG - Intronic
1065223978 10:23524218-23524240 TAGGAGCAGGAGCAGGAGCAGGG + Intergenic
1065360491 10:24884899-24884921 GACATGGAGGAGAAGGACCCAGG + Intronic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066554000 10:36591117-36591139 AAGGAGCAGGAGAAGGTGCTGGG + Intergenic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1067558167 10:47286648-47286670 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1067582299 10:47453277-47453299 GAGAAGCCAGAGAAACAGCCAGG + Intergenic
1067820418 10:49524089-49524111 GAGAAGGAGGAGGAGGAGGTCGG - Exonic
1067899887 10:50228792-50228814 GAGAAGCGGGATGAGGAGCAAGG + Intronic
1068460890 10:57326987-57327009 GAGAAGCAGGGGAGGGAGAGAGG - Intergenic
1068577494 10:58700493-58700515 GAGAAGCAGCAGCCGGGGCCAGG + Intronic
1068932956 10:62610422-62610444 GAGGAGGAGGAGAAGGGGCTGGG - Intronic
1069087790 10:64161694-64161716 CTGAAGCAGGAAAAGTAGCCGGG - Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069685740 10:70317296-70317318 CAGAAGCAGAAGCAGAAGCCAGG - Intronic
1069776155 10:70928480-70928502 GGGGAGCAGGAGATGGAGCTGGG + Intergenic
1069782308 10:70964654-70964676 GGGCTGCAGGAGAAAGAGCCGGG - Intergenic
1070363819 10:75716698-75716720 GAGACACATGAGAAGGAGGCAGG - Intronic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1071411500 10:85401448-85401470 GAGAAGCTGAAGGAGGAGCCAGG + Intergenic
1071476914 10:86033082-86033104 GAGAAGCTGGAATAGAAGCCTGG + Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1071738661 10:88331642-88331664 GAGAAGTTGGACAAGGAGCTGGG + Intronic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072940491 10:99759543-99759565 GAGAAGGGGGAGGAGGTGCCAGG + Intergenic
1073179560 10:101575453-101575475 GAGAAGCAAGACAATGGGCCTGG + Intronic
1073249851 10:102114746-102114768 GAGAAGGAGGAGGAGGAGAGAGG - Intronic
1073267277 10:102235251-102235273 GAGGAGCAGGCCAAGGGGCCAGG + Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073531731 10:104238658-104238680 GAGAAACAGGGGCAGGAGACAGG - Intronic
1073941192 10:108700369-108700391 GAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1074203646 10:111261342-111261364 GAGTAGCAGGAGGGGGAGCTGGG - Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1074772237 10:116741966-116741988 GCGAGGCAGGAGTGGGAGCCTGG - Intronic
1075148042 10:119899992-119900014 GAGAAGCAGGAGGAAGGGGCAGG - Intronic
1075278034 10:121112929-121112951 GAGAGGGAGGTGAAGGTGCCAGG + Intergenic
1075330149 10:121568122-121568144 GAGAAGGAGGAGAAGACGGCAGG + Intronic
1075403430 10:122177635-122177657 GAGCAGCAGGAGAATGAAGCTGG + Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075848719 10:125568346-125568368 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
1075918668 10:126191388-126191410 GAGCAGCAGGAGGGGAAGCCTGG + Intronic
1076401586 10:130188904-130188926 GAGAAGCAGGATCCGGAGCCTGG - Intergenic
1076614540 10:131747015-131747037 GAGAAGCAGGAGGGGGAGCAGGG - Intergenic
1076748023 10:132524128-132524150 GAGAAGCAAGAGAAAGAGACGGG - Intergenic
1076777629 10:132706824-132706846 GGGGACCAGGAGAAGGAGACAGG + Intronic
1076796001 10:132798813-132798835 GTGAGGTAGGAGAAGGGGCCTGG + Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077392580 11:2306935-2306957 GGGAAGGAGGAGAAGGAGGAGGG + Intronic
1077404136 11:2375256-2375278 GGGAAGCAGGAGACAGAGCCAGG - Intergenic
1077474242 11:2778896-2778918 GTGGGGCAGGAGCAGGAGCCTGG - Intronic
1077673882 11:4181023-4181045 GCTAAGGAGGAGAAGGTGCCTGG - Intergenic
1077728028 11:4696275-4696297 ATGAAGCAGGAGGAAGAGCCAGG - Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1077949014 11:6934139-6934161 GAGAAGCTTGATAAGCAGCCTGG + Intronic
1077999287 11:7480459-7480481 GAGAGGCAAGAGAGGGAGTCAGG - Intergenic
1078025974 11:7696066-7696088 GACAACCATGAGAAGGAGACAGG - Intronic
1078233225 11:9461164-9461186 GAGCAGCGGGAGCCGGAGCCCGG - Intronic
1078452425 11:11450125-11450147 GGGAAGTAAGAGATGGAGCCAGG + Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1078876850 11:15407887-15407909 GAGAAGCTGAAGAAGGATCCAGG - Intergenic
1079085883 11:17444537-17444559 GGGGAGCATGAGGAGGAGCCAGG - Intronic
1079152408 11:17912170-17912192 GAGAAGATGGTGAAGGAGACAGG + Intronic
1079703937 11:23589050-23589072 GAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1080159783 11:29159951-29159973 GAGAAGGAGAAGAAGGAGAATGG + Intergenic
1080786883 11:35483527-35483549 GAGAAGGAGGAGGAGAAGACAGG - Intronic
1081683761 11:45027101-45027123 GAGAGGGAGGAGAGGGAGACAGG - Intergenic
1081761499 11:45579599-45579621 GAGAAGGAGGAGAAGAAGGAAGG - Intergenic
1081836875 11:46162968-46162990 GAGAAGCTGCAGTGGGAGCCTGG - Intergenic
1081877866 11:46422571-46422593 GAAAAGAATGAGAGGGAGCCAGG + Intronic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082985582 11:59167822-59167844 GAGAGGCAAGAGAAAAAGCCAGG - Intergenic
1083101268 11:60308682-60308704 GAAAAGCAGGAGAAGGAAAAAGG - Exonic
1083307566 11:61769233-61769255 GAGAGCCAGGGGAAGGGGCCGGG - Intronic
1083421518 11:62556014-62556036 GAGAAACTGGAGAAGGGGTCGGG - Intronic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083810851 11:65105907-65105929 GAGGTGTAGGAGAAGGAGCATGG + Intronic
1083813835 11:65120772-65120794 GAGAAGAAGAAGAAGAAGACAGG - Exonic
1083822679 11:65181860-65181882 GAGGAGGAGGAGAAGGAGAGAGG + Intronic
1083845913 11:65333596-65333618 GAGGAGCAGGAGCCGGGGCCGGG - Intergenic
1083857722 11:65401356-65401378 GGGAAGCAGGGGAGGGAGGCAGG - Intronic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1084063502 11:66690388-66690410 AAGAAGCAGGGGGAGGAGCCAGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084691725 11:70731404-70731426 GAGATGGGGGAGAAGGAGCGGGG - Intronic
1085151378 11:74255058-74255080 GAGAGACAGGAGGAGGAACCTGG - Intronic
1085295206 11:75427580-75427602 AAGGAGCAGGAGAATAAGCCAGG - Intronic
1085458401 11:76678664-76678686 GAGAGGCAGGAGAAAGAGAGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086286112 11:85253479-85253501 TAGAAGCAGGTGCAGGAGCCAGG + Intronic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086719317 11:90100863-90100885 GAGAAGCAGCAGGAGCTGCCAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087453587 11:98354298-98354320 AAGAAGCATCAGAAGGGGCCAGG - Intergenic
1087526334 11:99318661-99318683 GAGTAGTGGGAGCAGGAGCCAGG - Intronic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1088394263 11:109349387-109349409 GAGAAGCAGATGAAGAAACCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089046321 11:115504308-115504330 CAGAAGCCGGAGCCGGAGCCCGG + Exonic
1089095426 11:115916264-115916286 GAGGAGGAGGAGGAGGAGCGAGG - Intergenic
1089155378 11:116398057-116398079 GAGATGCAGGAGAAGTGGCCAGG + Intergenic
1089318984 11:117612418-117612440 GGGAGGCAGGAGAAGGAAGCAGG - Intronic
1089359050 11:117874439-117874461 GGGAAGCAGGAAAACGTGCCAGG + Intronic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089579915 11:119475197-119475219 GAGAAGCAGAATAGAGAGCCAGG - Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089643489 11:119863204-119863226 GAGAAGCAGGATGAGGAGGATGG + Intergenic
1089773715 11:120821355-120821377 GAGGAGCAAGAGAGGGAGGCAGG + Intronic
1090038127 11:123266091-123266113 GGAAGGCAGGAGAAGGAGCAAGG + Intergenic
1090590383 11:128261098-128261120 GACAGGCAGGCGCAGGAGCCGGG + Intergenic
1090626846 11:128615569-128615591 GAGAAGCAGGAGGGAGAGCCAGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1091036481 11:132238306-132238328 GGGAGGCAGGAGAAGGAAGCAGG + Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091356867 11:134944115-134944137 GGGAAGCAGGAGAAGGGGAGGGG + Intergenic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091688726 12:2581652-2581674 GAGGAAGAGGAGAAGGAGCAGGG - Exonic
1091740388 12:2957079-2957101 GAGGAGGAGGGGAAGGAGCTAGG - Intergenic
1091771799 12:3156870-3156892 GTGGAGCAGGAGAAGGGCCCAGG + Intronic
1091800510 12:3321769-3321791 GGGAAGCCGGAGAAGGAACACGG + Intergenic
1092051626 12:5474925-5474947 GAGAGGCTGGAGGAGGAGCAGGG + Intronic
1092154477 12:6273594-6273616 GGGGAGCAGGGGAAGGAGCAGGG + Intergenic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092446733 12:8564776-8564798 GAGGTGGAGGAGGAGGAGCCGGG + Intergenic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093709357 12:22312186-22312208 GTGATCCAGGAGAAAGAGCCAGG - Intronic
1093895165 12:24566581-24566603 GAATAGCAGGTGAAAGAGCCTGG + Intergenic
1094052958 12:26240528-26240550 GAGGAGCAGGAGAAAGAGAGGGG + Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095943649 12:47741399-47741421 GAGAAGAGGGAGGAGGGGCCTGG - Intronic
1095960858 12:47833456-47833478 TAGAAACAGTAGAAGCAGCCTGG + Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096565439 12:52473794-52473816 GAGAAGCAGGACAAGGAATCGGG + Intergenic
1096567455 12:52493245-52493267 GAGAAGCAGGACTAGGAATCAGG + Exonic
1096584529 12:52611190-52611212 AAGAAGCAGGTGAAGGGGACTGG - Exonic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096695583 12:53346077-53346099 GGGGAGGAGGAGAGGGAGCCAGG + Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096848133 12:54419011-54419033 GAGAATCCGAAGAAGGAGCCCGG + Exonic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1097180476 12:57168924-57168946 GAGGAGGAGGAGAAGGCTCCTGG - Intronic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098268427 12:68746601-68746623 GAGGGCCAGGAGGAGGAGCCTGG - Exonic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098744047 12:74213301-74213323 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100565575 12:95790741-95790763 GAGAAGGACGGGACGGAGCCGGG - Exonic
1100732697 12:97490142-97490164 GAGAAATAGAAGAATGAGCCTGG + Intergenic
1100757889 12:97772696-97772718 GATGAGCAGGTGCAGGAGCCAGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101146276 12:101843752-101843774 TAGAAGCAGGAGTAGATGCCAGG - Intergenic
1101227454 12:102704161-102704183 GAGAAGCAGGAGAAGGGAGAAGG - Intergenic
1101580504 12:106037764-106037786 GAGAAGGAAGAGAAGGAGAGGGG - Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102014829 12:109641144-109641166 GAGAAGCAGGAAATGGGGCCGGG + Intergenic
1102027629 12:109722604-109722626 GACGGGCAGGAGAAGGGGCCAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102658258 12:114501926-114501948 GGGGAGCAGGAGAAGGAGAAAGG + Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102791316 12:115648344-115648366 GAGCAGCAAGAGAAGAAGCAAGG + Intergenic
1102983908 12:117263818-117263840 GAGAACCCAGAGAAGGAGGCTGG - Intronic
1103034680 12:117646954-117646976 GAGGAGAGGGAGAAAGAGCCAGG + Intronic
1103232854 12:119346411-119346433 GAGAAGCAGGTGATGGAGTTAGG + Intronic
1103252386 12:119511431-119511453 GACCAGCAGGAGGAGTAGCCTGG - Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103527722 12:121579101-121579123 GAAAAGCAGGACAAGGAGAGGGG + Intronic
1103736142 12:123062032-123062054 GAGAAGGAGGAGGAGGAGCAGGG - Intronic
1103886790 12:124208446-124208468 GGGGAGGAGGAGAGGGAGCCAGG - Intronic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104101435 12:125616377-125616399 GAGAGGCAGAAGAGGAAGCCTGG + Intronic
1104225816 12:126832076-126832098 GAGAAGGAGGAGGAGGAGAAAGG - Intergenic
1104301961 12:127572372-127572394 GAGAAGGAGAAGAAGGAGAAGGG + Intergenic
1104575585 12:129963308-129963330 CAGAAGCAGGAGGGGAAGCCAGG - Intergenic
1104675577 12:130709909-130709931 GGGAGGCAGGGGAAGGAGCGCGG + Intronic
1104731039 12:131105483-131105505 GAGAAGCAGGAACATGAGCTGGG + Intronic
1104900843 12:132188857-132188879 GAGGAGCAGGAGCAGGAGGGAGG + Intergenic
1105302770 13:19150821-19150843 AGGAAGCTGGAGAAGGAACCAGG - Intergenic
1105602784 13:21901978-21902000 GAGAAGCTTGAGAAGGAGCCAGG - Intergenic
1105819007 13:24063118-24063140 GAGCACTGGGAGAAGGAGCCTGG - Intronic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106255587 13:28019648-28019670 GACAGGCAGGAGGAGGAGGCAGG - Intronic
1106389963 13:29325507-29325529 GAGAAGGAGGAGGAGGAGGGAGG + Intronic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106948233 13:34852998-34853020 GAGATTCAGGAGAAACAGCCAGG - Intergenic
1107561946 13:41565162-41565184 GACAGGCACAAGAAGGAGCCAGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107967366 13:45609375-45609397 GAGAAACTTGAGAATGAGCCAGG - Intronic
1108036650 13:46297063-46297085 GAGATTCAGTAGAAGGGGCCAGG - Intergenic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1109132793 13:58610243-58610265 GATTAGGAGGAGGAGGAGCCAGG + Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111654203 13:91131988-91132010 GGGAAGCAGGAGAGGGAAGCAGG + Intergenic
1111654320 13:91132860-91132882 GAAAAGTAGGAGATGTAGCCAGG - Intergenic
1112074643 13:95898342-95898364 GAGAAGCCAGAGAAGTAGCTGGG - Intronic
1112091903 13:96091127-96091149 GAGGAGGAGGACGAGGAGCCCGG + Exonic
1112616404 13:101010839-101010861 GAGAAGCTTGCGAAGGAGCAGGG + Intergenic
1112872143 13:103985977-103985999 GAGAAGCAGGAGATGGTGAGAGG - Intergenic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113159616 13:107365024-107365046 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
1113635007 13:111913390-111913412 GAGAGGGAGGAGGAGAAGCCTGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113792334 13:113035549-113035571 AGGCAGCAGGCGAAGGAGCCAGG - Intronic
1113855833 13:113445025-113445047 GAGAAGAAGGAGCTGGAGCTGGG - Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114516389 14:23302449-23302471 GAGGAGCCGGAGGAGGAGCCAGG - Exonic
1114533713 14:23410381-23410403 GAGCAGGGAGAGAAGGAGCCTGG - Intergenic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1114631286 14:24161059-24161081 GGGAGGCAGGGGAATGAGCCAGG + Exonic
1114873865 14:26691082-26691104 GAGAGGGAGGAGAAGGACACAGG - Intergenic
1115167461 14:30464873-30464895 GAGAAGGAGGGGCAGGAGGCAGG + Intergenic
1115204590 14:30888268-30888290 GAGAGTCAGGAAAAGGAGACTGG + Intronic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115443783 14:33466166-33466188 GAGAAGCAAGAGAGGGACCATGG + Intronic
1115460115 14:33650862-33650884 CAGGAGCAGGAGCAGGACCCAGG + Intronic
1115500767 14:34047547-34047569 GAGAGAGAGGAGAAGGTGCCAGG + Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115642094 14:35341495-35341517 GAGGCCCTGGAGAAGGAGCCTGG - Intergenic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1115990875 14:39148210-39148232 GAGAAGCAGAAGAGGGATGCTGG + Exonic
1116114535 14:40629998-40630020 GAGAAGCGGGAGCGGGAACCCGG - Intergenic
1116479773 14:45383889-45383911 GAAAAGCAGGTGCAGGAGCCAGG - Intergenic
1116680568 14:47964484-47964506 CAGGAGCAAGAGAAGAAGCCTGG - Intergenic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117497518 14:56320128-56320150 CAGAAGCAAGAGAGGGAGCGGGG - Intergenic
1117649066 14:57883033-57883055 GAGAAGGAGGAGAAGGGGAGGGG + Intronic
1118110423 14:62712054-62712076 GAGAAGCAGGTGCAGGAGGAAGG + Intronic
1118171699 14:63395446-63395468 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1118370048 14:65130165-65130187 GAGAGGCAGGCACAGGAGCCGGG - Intergenic
1118456141 14:65947013-65947035 GAGAAGCAGAAGAAAGTTCCTGG + Intergenic
1118459544 14:65976007-65976029 GGGAAGCAGGAGAAGGAGGGAGG + Intronic
1118886891 14:69874929-69874951 GAGAAATAATAGAAGGAGCCTGG + Intronic
1119067339 14:71542236-71542258 GAGGAGGAGGAGGAGGAGCCAGG - Intronic
1119086480 14:71743944-71743966 GAGGAGCAATAGAAGGGGCCAGG - Intergenic
1119282022 14:73417371-73417393 GACAGGCAGGTGCAGGAGCCAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119432569 14:74578077-74578099 GAGGGGCTGGAGCAGGAGCCAGG + Intronic
1119539841 14:75430677-75430699 GACAAGCAACAGAATGAGCCAGG - Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119594058 14:75917628-75917650 GAGAGGGAGGATAAGGAGCAAGG + Intronic
1119783797 14:77297549-77297571 GGGAAGCAGGAGAAGAAGTTGGG - Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120055611 14:79920393-79920415 GAGATGCAGCAGAAGGTGTCGGG + Intergenic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121533834 14:94677562-94677584 GAGAGGCAGGAGGAGGAAGCAGG + Intergenic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121821495 14:96971763-96971785 GAGAAGGAGGAGAAGAAGGGAGG + Intergenic
1121832092 14:97061375-97061397 GAGAAGCAGGAACAGAAACCTGG - Intergenic
1121893599 14:97623305-97623327 GAGGAGCGGGAGAAGAAGCAGGG + Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122275916 14:100590787-100590809 GACAAGCAGGTGAAGGAACAGGG - Intergenic
1122304199 14:100751404-100751426 GGGAAGCAGAAGGAGGATCCGGG - Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1122577126 14:102749611-102749633 GAGAAGCAGCTGAAGGGGCTGGG - Intergenic
1122811209 14:104290245-104290267 GAGAAGCAGCAGCAGGAAGCAGG - Intergenic
1123552709 15:21398279-21398301 GAGCAGCAGGATCAGGAGCACGG - Intergenic
1123588955 15:21835667-21835689 GAGCAGCAGGATCAGGAGCACGG - Intergenic
1124044608 15:26137446-26137468 GAAAAGGAGGAGAGGGAGGCAGG - Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125225847 15:37395544-37395566 GACAAGCAAGAGAGGGAGCTTGG - Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125684833 15:41558259-41558281 TAGAAGCAGGGGAAGCAACCAGG + Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1125999384 15:44195015-44195037 GAGCGGCAGCAGCAGGAGCCTGG - Exonic
1126850044 15:52791046-52791068 GCTGAGCGGGAGAAGGAGCCAGG - Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1128146916 15:65337046-65337068 GGGAGCCAGGAGCAGGAGCCAGG - Intronic
1128217486 15:65944516-65944538 GAGAGGCAGCAGCAGGAGCCTGG + Intronic
1128522982 15:68387713-68387735 TAGAAGCAGCTGAAGGGGCCGGG - Intronic
1128598610 15:68976028-68976050 GAGAGGCACGAGCAGGAACCGGG - Intronic
1128644171 15:69362822-69362844 GAACAGCAGGCGAGGGAGCCGGG - Intronic
1128670015 15:69567716-69567738 GAGAGGCACGAGCAGGAACCCGG - Intergenic
1129172681 15:73817627-73817649 GCGAAGCAGGAGGAGAAGGCAGG + Intergenic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129468510 15:75737741-75737763 AAGCAGCTGGGGAAGGAGCCTGG - Intergenic
1129705439 15:77791562-77791584 TACAAGCAGGAGAAGGATTCTGG + Intronic
1129727071 15:77906766-77906788 AAGCAGCTGGGGAAGGAGCCTGG + Intergenic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1129946462 15:79543051-79543073 GAGAAGCACAAGAAGTAGGCTGG + Intergenic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131757484 15:95581285-95581307 GAAAAGTTGGAGAAGGTGCCAGG - Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131885022 15:96903175-96903197 GAGGAGCAGTAGAAGGAGATTGG - Intergenic
1132121486 15:99179733-99179755 CAGAAGCAGGTGGAGGGGCCTGG + Intronic
1132220108 15:100099012-100099034 GAGGTGCAGGACAAGGAACCAGG - Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1202961059 15_KI270727v1_random:125499-125521 GAGCAGCAGGATCAGGAGCACGG - Intergenic
1132507412 16:318373-318395 GAGAAGCGGGAGAAGGCGGCTGG + Intronic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132700786 16:1221152-1221174 GCGAAGCAGGAGTAGCTGCCGGG + Exonic
1132714970 16:1285715-1285737 GAGCAGCGGGAGAAAGAACCGGG + Intergenic
1132720293 16:1312319-1312341 AAAAAGCAGGCGAAGGAACCTGG - Intronic
1132724245 16:1332077-1332099 GGGAAGCAGGGGAGGGGGCCTGG - Intergenic
1132764432 16:1527059-1527081 GGGAAAAAGGAGGAGGAGCCTGG - Intronic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133202146 16:4210223-4210245 GAGATGTAGGTGAAGGAGTCAGG - Intronic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133743194 16:8667089-8667111 GAAAATCAGGAGACAGAGCCGGG - Intergenic
1133760815 16:8797165-8797187 GCGGAGAAGGAGAAGGAGCGAGG + Intronic
1134018611 16:10906605-10906627 GAGGAGCAGCAGCAAGAGCCTGG + Exonic
1134057162 16:11177781-11177803 GAGGAGGAGGAGGAGGAGACAGG + Intronic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134625195 16:15718361-15718383 GAGGAGCTGGAGGAGGAGCAGGG - Exonic
1134693069 16:16203732-16203754 GAGGAACAGGTGAGGGAGCCAGG - Intronic
1134978778 16:18590963-18590985 GAGGAACAGGTGAGGGAGCCAGG + Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135290298 16:21230774-21230796 GAAGAGCAGTAGAAGCAGCCTGG - Intergenic
1135340072 16:21637721-21637743 GAGAGGCACGGGCAGGAGCCGGG - Intronic
1135488744 16:22888678-22888700 GAAAAGCCAGAGACGGAGCCAGG - Intronic
1135533773 16:23276906-23276928 GAGAAACAGGAGAAAGAACAAGG + Intergenic
1135582574 16:23641102-23641124 GAGGAGAAGGAAAAGGTGCCGGG - Exonic
1135887882 16:26328906-26328928 GGTGAGCAGGAGCAGGAGCCAGG + Intergenic
1135912493 16:26574107-26574129 GGGAGGCAGGAGAGAGAGCCAGG + Intergenic
1136360818 16:29778581-29778603 GAGAAGTTGCAGAAGGAGTCGGG - Intronic
1136366325 16:29810859-29810881 GGGGAGCAGGAGGAAGAGCCAGG + Exonic
1136634001 16:31507902-31507924 GAGAAGCGGGCGTAGGAGCGTGG + Intronic
1137557024 16:49477227-49477249 GAGAAGGAGGGGAAGGAGGAGGG + Intergenic
1137582771 16:49644097-49644119 GAGATGCTGGAGAAGGTGCTCGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137677341 16:50310228-50310250 GAGAACTGGGAGATGGAGCCGGG + Intronic
1137694581 16:50453018-50453040 GAGAAGCAGCAGAAGAAGAAAGG + Intergenic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1137822108 16:51456062-51456084 GAGAAGAAGAAGGAGGAGCAGGG + Intergenic
1137861174 16:51848563-51848585 GAGAAGCAGCAGCAGGATTCAGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138382051 16:56609259-56609281 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138383338 16:56618585-56618607 GGGCAGCAGGAGCAGCAGCCTGG - Intergenic
1138385600 16:56633747-56633769 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138386651 16:56639855-56639877 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138389408 16:56659069-56659091 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138390459 16:56666952-56666974 GGGCAGCAGGAGCAGCAGCCTGG + Exonic
1138392155 16:56677648-56677670 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138393059 16:56683954-56683976 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138537660 16:57668373-57668395 GAGCAGGAGGAGCAGGAGCAGGG - Exonic
1138538436 16:57673242-57673264 GAGGAGCAGGGAAAGGAGCTGGG - Intronic
1138619124 16:58197842-58197864 GAGGAGGAGGAGGAGGAGCGCGG + Exonic
1138649363 16:58450296-58450318 AGGATGGAGGAGAAGGAGCCTGG + Intergenic
1138868981 16:60857996-60858018 GAGAAGGAGGAGGAAGAGCGGGG - Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139988568 16:70920682-70920704 GGGAAGAAGGAGAAGGACCTGGG - Exonic
1140339056 16:74139458-74139480 GATAGGCAGGTGCAGGAGCCAGG + Intergenic
1140899590 16:79355485-79355507 GAGAAGTGAGAGAAGGAGCCTGG + Intergenic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140963234 16:79937821-79937843 GAGGAGGAGGAGAAGGAGAGGGG - Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141457184 16:84151042-84151064 GAGAGGCGTGAGCAGGAGCCAGG + Intronic
1141775801 16:86121890-86121912 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1141788937 16:86219871-86219893 GAGCAGGACGCGAAGGAGCCTGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142115530 16:88354261-88354283 GAGAAGCAAGGGATGGTGCCTGG + Intergenic
1142250722 16:88990616-88990638 GGGAAGGAAGAGAAAGAGCCAGG + Intergenic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1142827385 17:2522292-2522314 GAGAAGCAGGAGAGGCTGTCGGG + Intergenic
1142869602 17:2811423-2811445 GAGAAGCAGGAAAAGAACCAGGG - Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143104030 17:4519558-4519580 GAGAGGCAGGGCAGGGAGCCAGG - Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143391289 17:6560774-6560796 GAGAAGGAGGAGAATGAGAAAGG - Intergenic
1143416865 17:6756724-6756746 GAGCAGGGGGAGAAGGGGCCAGG + Intronic
1143608253 17:8003148-8003170 GAGCAGCAGGAGCGGGAGCCGGG - Exonic
1143638859 17:8183845-8183867 GAGGAGGAGGAGACGGAGCCGGG - Intergenic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1143661513 17:8327237-8327259 GAGAACCAGGAGACACAGCCAGG - Intergenic
1143981593 17:10874712-10874734 GAGGTGCAGAAGAAGGTGCCTGG - Intergenic
1144134393 17:12279406-12279428 GGGTAGCAGGAGAAGCAACCTGG + Intergenic
1144201086 17:12943366-12943388 GGGAAGCAGGAGAACCAGACAGG - Intronic
1144208302 17:12994507-12994529 GAGAAGCAGCACAAGGATCAGGG + Intronic
1144235668 17:13258079-13258101 GGGAAGAAGGAGAAGGAGAAGGG - Intergenic
1144474328 17:15572257-15572279 GTGAAGCAGGCGGAGGAGCTAGG - Exonic
1144702793 17:17349837-17349859 GAGCAGCAGGAGGAGGCCCCGGG + Intergenic
1145281548 17:21471065-21471087 GGGAAGCAGGAGATGGAACCAGG + Intergenic
1145395880 17:22494548-22494570 GGGAAGCAGGAGATGGAACCAGG - Intergenic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146455227 17:33004450-33004472 GAGAAGGAGGAGAAGGGGAATGG + Intergenic
1146547132 17:33749268-33749290 GAGCAGCTGGAGAAGGAGAGGGG - Intronic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1146824707 17:36012468-36012490 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147725555 17:42564331-42564353 GAGTCGGAGGAGGAGGAGCCTGG + Intronic
1148212618 17:45817576-45817598 GAGGGGCAGGAGAAGGAATCTGG - Intronic
1148379930 17:47189032-47189054 GGGAGGCGGGAGAAGCAGCCGGG + Intronic
1148552412 17:48558386-48558408 GAGAAGCAAGAAAATGAACCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148763970 17:50026880-50026902 GAGAGGCAGGAGGAGGAACAGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148945555 17:51259724-51259746 GAGAAGCAGGCCAGGGAGCGGGG + Intronic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1150218906 17:63484899-63484921 GAGCAGCAGGAAGAGGAGGCTGG - Exonic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150492565 17:65584386-65584408 GACAGGCAGGGGAAGGAGCTGGG + Intronic
1150667255 17:67152829-67152851 CAGAAGCTGGGAAAGGAGCCTGG + Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150765305 17:67997364-67997386 GAAAAGAAAGAGGAGGAGCCAGG + Intergenic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151351369 17:73534042-73534064 GAGGAGGAGGAGGAGGAGCAGGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151657363 17:75502270-75502292 GACACGGAGGAGGAGGAGCCAGG - Exonic
1151883518 17:76909733-76909755 GAGTAGTGGGAGAAGGAGGCTGG + Intronic
1152161836 17:78673664-78673686 CAGAAGCAGGGGAAGGCGCTTGG - Intergenic
1152268359 17:79309396-79309418 GAGAAGCAGCAGGAGGGGGCGGG - Intronic
1152344279 17:79742016-79742038 GAGGAGCAGGAGCAGGGGCAGGG - Exonic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152464126 17:80456271-80456293 GAGAAGGAGGGGAAGCAGTCTGG + Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152494948 17:80664477-80664499 GGGAAGGAGGAGAAGGAGAAGGG - Intronic
1152776650 17:82206090-82206112 GAGCGGCAGGAGAAGCCGCCGGG + Intronic
1153673647 18:7436340-7436362 GCCACGCAGGAGAAGGAGCATGG - Intergenic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1154041381 18:10859526-10859548 GTGATGCAGGAGAGAGAGCCAGG - Intronic
1154453622 18:14501676-14501698 GAGCAGCAGGATCAGGAGCACGG - Intergenic
1154497798 18:14975186-14975208 GGGAAGCAGGAGAAGGGGAGGGG - Intergenic
1155000507 18:21681527-21681549 GAGATGGAGGGGAAGGAGGCTGG - Intronic
1155057495 18:22197780-22197802 GAGAAGGAGGGGAAGCAGCTTGG - Intronic
1155066207 18:22271210-22271232 GAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1155290441 18:24335692-24335714 GAGAAGCAGGTTGGGGAGCCAGG + Intronic
1155364732 18:25038643-25038665 GAGAAGCAGGAGGCAGAGGCAGG + Intergenic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156395221 18:36693257-36693279 GAGAAGCCGGAGTGTGAGCCGGG + Exonic
1156399124 18:36724915-36724937 GAGAAGCCTGGGAAGCAGCCAGG - Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156964884 18:43078891-43078913 GAGGAGCGGGAAAAGGAGCAGGG + Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157357522 18:46949215-46949237 GAGAAGGAGGAGAAGTAGTTAGG - Intronic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1157605633 18:48924309-48924331 GAGGAGGAGGAGGAGGAGCAAGG + Intronic
1158134995 18:54198335-54198357 TAAAAGCAGGAGAAGGAGCTTGG - Intronic
1158542475 18:58369649-58369671 AAGGAGCAGAAGCAGGAGCCTGG + Intronic
1158582394 18:58695341-58695363 GAGAGGCAAGAGAAGGAGTTGGG + Intronic
1158750403 18:60252915-60252937 GAGAAGCAAGAGAGTGAGACTGG - Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159472988 18:68880354-68880376 GAGAGGCACGAGCAGGAACCGGG - Intronic
1159927381 18:74281445-74281467 GAGAAGTGGGAAAAGGAGACAGG + Intronic
1160065781 18:75573098-75573120 AACAAGAAAGAGAAGGAGCCAGG - Intergenic
1160072891 18:75643676-75643698 CAGCAGCAGGTGAGGGAGCCAGG - Intergenic
1160227009 18:77019419-77019441 GTGAAGATGGAGGAGGAGCCTGG + Intronic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160705048 19:525767-525789 GAGAAGGAAGAGAAGGAGAGAGG + Intergenic
1160804418 19:985741-985763 GAGAACCAGGAAGAGGAGTCGGG - Intronic
1160881816 19:1324438-1324460 CAGAAGGGCGAGAAGGAGCCAGG + Intergenic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1160969611 19:1761721-1761743 GAGAGGCTGAACAAGGAGCCAGG + Intronic
1161021057 19:2011747-2011769 GAGGAGCAGGAGCAGGAGGGTGG - Intronic
1161030286 19:2054934-2054956 GAGGAGGAGGAGAGGAAGCCAGG - Intergenic
1161299943 19:3537714-3537736 GAGAAGAGGGTGAAGGAGCTGGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161610546 19:5240053-5240075 GAGACGCAGGAGAAGCAGAAGGG + Intronic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161991435 19:7686401-7686423 GAAGAGGAGGAGGAGGAGCCAGG + Exonic
1162178125 19:8846971-8846993 GACAGGCAGGTGCAGGAGCCGGG + Intergenic
1162570983 19:11472767-11472789 GAGAAGGAGAAGAAGAAGCCAGG + Intronic
1162797937 19:13096149-13096171 GAGACGCAGGAGGAGGAGTAAGG - Exonic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1162984122 19:14258390-14258412 GAAGAGCAGGAGGAGGAGCAGGG - Intergenic
1163222133 19:15929339-15929361 GAGAAGCAGGAAGAGGGGCCTGG + Intronic
1163359558 19:16837212-16837234 GAGAAGGGGGAGAGGGAGCCAGG + Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164148742 19:22530559-22530581 GAGAAGCGGGAGAATGGGTCTGG - Intronic
1164250197 19:23469100-23469122 GAGAAGGAGGAGAAAGAGAAGGG - Intergenic
1164292166 19:23878693-23878715 GAGAAGGAGGAGGAGGAGTAAGG + Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164654488 19:29910502-29910524 GAGATGCAGGAGAGGGAGGGAGG - Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164718705 19:30415256-30415278 GAGGAGCAGGAGGAGGAGAAGGG - Intronic
1164740403 19:30571640-30571662 GAGAAGCAGGAGCAGGAAGTGGG - Intronic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1165326122 19:35115513-35115535 GAGGAGGAGGAGCAGGAGACAGG + Intergenic
1165726579 19:38117109-38117131 CAGAAGCAGGAGAGGTAACCAGG - Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166432831 19:42741344-42741366 GAGATGCAGGAGGGGGAGCCTGG + Intronic
1166445815 19:42856599-42856621 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166448800 19:42880559-42880581 GAGATGCGGGAGGGGGAGCCTGG + Intronic
1166453200 19:42918747-42918769 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166455685 19:42938058-42938080 GAGACACAGGAGGGGGAGCCTGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166471614 19:43083537-43083559 GAGACGCAGGAGGGGGAACCTGG + Intronic
1166482758 19:43187353-43187375 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166485232 19:43206487-43206509 GAGACGCAGGAGGGGGAGCCTGG + Intronic
1166492382 19:43270405-43270427 GAGACGCAGGAGGGGGAGCCTGG + Intergenic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167154559 19:47730192-47730214 AGGAAGCAGGGGAAGGTGCCAGG - Intronic
1167215286 19:48160467-48160489 GAGGAGCAGCAGGAGGGGCCTGG + Intronic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167415548 19:49369536-49369558 GAGAACCAGGAGAAGGGGAAGGG + Intronic
1167451200 19:49570643-49570665 GGGAAGTCGGAGGAGGAGCCTGG - Intronic
1167483462 19:49746662-49746684 GAGAAGCAGAAGCCGGAGGCTGG - Exonic
1167643024 19:50692533-50692555 GAGAAGCAGAAGCAGGAACAGGG - Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167713249 19:51125092-51125114 GAGGGGTAGGAGAAGGAGCAGGG - Exonic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1168058474 19:53877020-53877042 GGGATGGAGGAGAAGGAGGCTGG - Intergenic
1168164020 19:54534212-54534234 GAGCAGCAGGAGAATCTGCCTGG + Intronic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925220267 2:2133798-2133820 GAGAGTCAGGAAAAGTAGCCTGG - Intronic
925365074 2:3305634-3305656 GAGGAGCAGGTGCAGGAGACGGG + Intronic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925922995 2:8650531-8650553 GGGGAGCAGGGGAAGGAGCTAGG - Intergenic
926213587 2:10889822-10889844 CAGAAGCTGTAGGAGGAGCCAGG + Intergenic
926302253 2:11612791-11612813 GAGAATCAGGAGAAGGGGCACGG - Intronic
926340760 2:11902730-11902752 GAGAAGGAGGGCCAGGAGCCTGG - Intergenic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926801203 2:16662647-16662669 GAGAAGCATGGCAGGGAGCCAGG - Intronic
926909957 2:17843355-17843377 GGGAAGCATGAGAAGAAGACGGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927187353 2:20491313-20491335 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
927283418 2:21331790-21331812 GAGAAACTGGAGCAGAAGCCAGG + Intergenic
927338208 2:21950039-21950061 GAAAAGAAAGAGAAGGAGACAGG - Intergenic
927415282 2:22872882-22872904 GATAAGTAGGAGAAGGATGCTGG - Intergenic
927670579 2:25065658-25065680 GAGAAGCAGGTGAAGGCACAGGG - Intronic
927951826 2:27175611-27175633 TAGAACGGGGAGAAGGAGCCAGG - Intergenic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929462997 2:42118307-42118329 CAGAAGCAGGAGAAAGACCTAGG - Intergenic
929509574 2:42556196-42556218 GAGAAGCAGAAGAATGAGACTGG - Intronic
929808624 2:45169779-45169801 GAGAAGGAGGAAACGGACCCTGG - Intergenic
930149824 2:48047428-48047450 GAGAAGCTGAAGGAGGATCCAGG - Intergenic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
931465366 2:62482022-62482044 GAGAAGCTGAAGAAGGATCCAGG + Intergenic
931636098 2:64341816-64341838 GAGAAGCAGGAGAAGTACTCTGG - Intergenic
931813948 2:65881679-65881701 GAGAAGCAAGAAAAGGAGTGAGG + Intergenic
931932837 2:67160402-67160424 GAGAACCAGGGGAAGAAGCAGGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932169306 2:69539145-69539167 GAGAAGAAAGCCAAGGAGCCTGG + Intronic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932299485 2:70656058-70656080 GAGCAGCAGTGGAAAGAGCCAGG + Intronic
932437407 2:71710732-71710754 GGCAGGGAGGAGAAGGAGCCAGG - Intergenic
932594622 2:73086385-73086407 GGGAAGCAGGAGAAAGAGGATGG + Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933443771 2:82350253-82350275 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
933690838 2:85178474-85178496 AAGGAGCTGGAGAAGGAGCAGGG + Intronic
934049199 2:88196191-88196213 GAGCAGCAGGGGCAGGAGCGGGG - Intergenic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
934747737 2:96770594-96770616 GAAAAGGAGGGGAAGCAGCCCGG - Intronic
934778320 2:96952922-96952944 GAGAAGCAGAAGGAGGAGGTTGG - Intronic
934898456 2:98139004-98139026 GAGAGGCACGAGCGGGAGCCGGG + Intronic
934941809 2:98508214-98508236 GGGAAGCAGGAGCAGGCACCAGG + Intronic
935646216 2:105337450-105337472 CAGCAGCGAGAGAAGGAGCCCGG + Exonic
935750009 2:106223581-106223603 GAGAAAGAGGAGGAGGGGCCAGG + Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936512219 2:113157503-113157525 GGGAGGCCGGAGCAGGAGCCCGG + Intronic
936619561 2:114081563-114081585 GAGAAGCAAGAGAAGAAACAAGG - Intergenic
937045040 2:118846745-118846767 GAGGCGCAGGAGGAGGAGGCCGG - Exonic
937170329 2:119859599-119859621 GAGAAGCTGAAGAGGAAGCCTGG - Intronic
937209634 2:120260110-120260132 GAGAGGCACGAGCAGGAACCGGG - Intronic
937264196 2:120605864-120605886 GAGAAGGAAGGGAAGGAGACAGG + Intergenic
937273353 2:120669323-120669345 GAGAAGCAGGAGGCGGGGACAGG + Intergenic
937419245 2:121740810-121740832 GGGAAGGAGGAGAGGGGGCCTGG - Intronic
937644459 2:124250646-124250668 GGGGAGCTGGAGGAGGAGCCTGG + Intronic
937674098 2:124570463-124570485 GAGATGCAGGAAATGCAGCCAGG + Intronic
937686812 2:124706847-124706869 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
938478266 2:131635478-131635500 GAGCAGCAGGCTCAGGAGCCGGG + Intergenic
938589167 2:132720576-132720598 GAGCAGCTAGGGAAGGAGCCAGG + Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939303860 2:140384064-140384086 GAAAAGCAGGAGAAGAAGGAAGG - Intronic
939798513 2:146678510-146678532 GGTAAGCAGGTGCAGGAGCCAGG + Intergenic
939994250 2:148905683-148905705 GAGAAGGGAGAGATGGAGCCAGG + Intronic
940047537 2:149425165-149425187 GAGACGCAGGAAGAGGATCCAGG - Intronic
940939736 2:159545187-159545209 GAGAGGCAGGAGAAGGGACTGGG - Intronic
941122148 2:161542685-161542707 GTGGGGCAGGAGAAGGAGTCGGG + Intronic
941267840 2:163385500-163385522 GAGATGCAGGGAAGGGAGCCTGG + Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
942173382 2:173308655-173308677 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942299629 2:174548906-174548928 GAGAGGCAGGGGCAGGAACCGGG - Intergenic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
943188135 2:184640183-184640205 AAGAAGTAGGAGGAGGAGCAGGG + Intronic
943570289 2:189565603-189565625 GAGAGGCAGGTGAAAGAGGCAGG + Intronic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944813050 2:203346748-203346770 GAGAAATAGGAGAAAGAGCAGGG + Intronic
945190447 2:207182097-207182119 GAGAGGCAAGAGAAGCATCCAGG - Intergenic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
945617753 2:212094589-212094611 GAGAGGCAGGCGGAGGTGCCAGG - Intronic
945987531 2:216367312-216367334 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
946035174 2:216736274-216736296 GAGACGCAGTAGAAGGAGTTAGG + Intergenic
946382966 2:219361499-219361521 GAGAATCAGGAGCAGAATCCAGG + Intergenic
946389071 2:219404771-219404793 GAAGACCAGGAGAAGCAGCCTGG + Intergenic
946397143 2:219448842-219448864 GAGAAGCCGGGGGACGAGCCTGG + Exonic
946427723 2:219608334-219608356 GGGAAGGAGGAGAAGGAGGAGGG + Exonic
946483462 2:220078454-220078476 GAGGAAGAAGAGAAGGAGCCTGG + Intergenic
946535175 2:220619962-220619984 GAGAAGCAAGAGAAAGAGAGAGG - Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948293223 2:236842763-236842785 GGGAGGCAGGAGAAGAAGCCAGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948766151 2:240220557-240220579 GAGAAGCAGCAGAATTAGACAGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
948913051 2:241014956-241014978 GAGAAGCAGGAGGGAGAGCCCGG - Intronic
1168960020 20:1862548-1862570 GAGAAGCAGGAGCAAGGGCCAGG + Intergenic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169123377 20:3110463-3110485 TGGAAGCGGGAGAGGGAGCCTGG + Intronic
1169138054 20:3209603-3209625 AAGAAGCTGGAGGAGGTGCCGGG + Exonic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1170150495 20:13221692-13221714 GGGGAGGAGGAGTAGGAGCCCGG - Intergenic
1170477446 20:16730013-16730035 CAAAAGCAGGAAACGGAGCCAGG - Exonic
1170714100 20:18817287-18817309 GAGATGGAGGGGCAGGAGCCTGG + Intronic
1170843516 20:19943115-19943137 AACAGGCAGAAGAAGGAGCCAGG - Intronic
1170916908 20:20635133-20635155 GAGGAGAATGAGGAGGAGCCAGG + Intronic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1171211511 20:23320731-23320753 GACAAGCAGGTGCAGGAGCCAGG + Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172124252 20:32615944-32615966 GAGAAGCAGAGTAAGGAGCCAGG + Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172444636 20:34986640-34986662 GAGAACCAGAAAAAGAAGCCAGG + Intronic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172765426 20:37348257-37348279 GAGAAGCAAAAGCAGGAACCAGG - Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172856632 20:38009352-38009374 GAGGAGCAAGAGAAGGAGTTTGG - Intronic
1172951687 20:38726647-38726669 GGCAAGCAGGAGGAGGAGCTTGG - Intronic
1172977614 20:38918625-38918647 GAGATGGAGGAGAAGGTGCATGG + Exonic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173163624 20:40670935-40670957 GAGAGCCAGGGTAAGGAGCCTGG - Intergenic
1173370435 20:42429927-42429949 GAAAAGCAGGAGAGGGAACTGGG + Intronic
1173522724 20:43711578-43711600 GAGAAGCAGAAGAGGAAGCCTGG + Exonic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173828868 20:46065451-46065473 GAGAATCAAGAGAAGGACCTGGG - Intronic
1173869232 20:46331299-46331321 GGGAAGGAGGGGAAGGAGACAGG + Intergenic
1174039519 20:47688994-47689016 GAGAAGCAGGAGAACTTTCCAGG + Intronic
1174166089 20:48584517-48584539 GGGAAGCAGAAGAAGGAAGCAGG - Intergenic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174519597 20:51119318-51119340 CAGAAGCAGGACCGGGAGCCAGG + Intergenic
1174677474 20:52372463-52372485 GAGGTTCAGGAGAAGGATCCAGG - Intergenic
1174724161 20:52843865-52843887 GAGAAGGAGGAGCAAGAACCAGG + Intergenic
1174979399 20:55376162-55376184 GAGAAGCTGCAGGAGGAGCCAGG - Intergenic
1174997710 20:55589596-55589618 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175073396 20:56353622-56353644 GAGAAGCAGGAGCAGCAGGAGGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175203008 20:57290873-57290895 GAGAAGCTGTAGGAGGAGCCAGG - Intergenic
1175219357 20:57408127-57408149 GAGAGGCAGGAGAAGGTGCAAGG - Exonic
1175427606 20:58878808-58878830 GAGATGCAGGAGCAGCATCCTGG + Intronic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176009458 20:62884875-62884897 GGGAAGCAGGAAAACCAGCCGGG + Intronic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1176411504 21:6451702-6451724 GGGAAGCAGCAGAGGGAGTCAGG + Intergenic
1176676974 21:9787796-9787818 GATAAGCAAGAGCAGGAGACTGG - Intergenic
1176801627 21:13435977-13435999 GAGAAGCAGGGGAGGAGGCCAGG - Intergenic
1176820561 21:13651629-13651651 GAGCAGCAGGATCAGGAGCATGG + Intergenic
1177201391 21:17960606-17960628 GAGAATCTGGTGAAGGAGACAGG - Intronic
1177249368 21:18572253-18572275 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1177333013 21:19685123-19685145 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1177368276 21:20167711-20167733 GAGAAGCAGGGGAAGGTGCCAGG + Intergenic
1177483505 21:21724630-21724652 GAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1178044059 21:28674519-28674541 GAGAAGCAGGACAAGCTCCCTGG - Intergenic
1178930558 21:36814922-36814944 GAGAAGCAGGTGGAGGAGTGGGG + Intronic
1178930840 21:36817543-36817565 AAGAAGCAGGCGGAGGAGCAGGG - Intronic
1179182420 21:39057211-39057233 GTGAGGCTGGAAAAGGAGCCAGG - Intergenic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1179510952 21:41873169-41873191 CACATGCAGGAGAAGGAACCAGG - Intronic
1179547745 21:42124081-42124103 AAGAAGCAGGACCTGGAGCCAGG - Intronic
1179570032 21:42273249-42273271 GTGGAGGAGGAGCAGGAGCCCGG + Intronic
1179686998 21:43060024-43060046 GGGAAGCAGCAGAGGGAGTCAGG + Intronic
1179789572 21:43748703-43748725 GAGAAGGAGGTGAAGGAGAGAGG - Intronic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1180228885 21:46414524-46414546 GAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181051540 22:20240438-20240460 GAGAAGCGGGCGGAGGAGCTGGG + Intergenic
1181323452 22:22026086-22026108 GAGAAGCTGGAGGAGGAGAGGGG - Intergenic
1181403888 22:22668330-22668352 GGGGAGCAGGAGAGGGATCCAGG - Intergenic
1181404387 22:22672425-22672447 GAGGAGGAGGAGATGGAGCAGGG + Intergenic
1181408848 22:22704105-22704127 GAGAAGCAGACGAAGGAAGCTGG + Intergenic
1181411041 22:22719951-22719973 GAGAAGGAGGAGATGGAGCAGGG + Intergenic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1181414167 22:22747425-22747447 GGGGAGCAGGAGAGGGATCCAGG - Intronic
1181426988 22:22850174-22850196 GGGGAGCAGGAGAGGGATCCAGG - Intronic
1181636902 22:24178743-24178765 GAGATGCTGGAGAAGGAGGGGGG - Intergenic
1181963736 22:26642234-26642256 GAGGGGCAGGAGGAGGAACCAGG - Intergenic
1182044320 22:27262492-27262514 AAGAAGCAGGGGTGGGAGCCAGG + Intergenic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182285867 22:29246585-29246607 GAGAACCAGGAGAAGCAAGCAGG + Intronic
1182364208 22:29766972-29766994 AGGACGCAGGAGGAGGAGCCCGG - Intronic
1182420504 22:30246401-30246423 GAGGAGGAGGAGAAGGAGAGGGG + Intronic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182931478 22:34178308-34178330 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183103139 22:35596271-35596293 AGGACCCAGGAGAAGGAGCCTGG - Intergenic
1183184786 22:36285704-36285726 GAGGAGCTGGAGGAGGAGCAGGG - Exonic
1183302034 22:37063218-37063240 GAGAGGCAGCAGAAGGGGCTGGG + Exonic
1183325096 22:37187123-37187145 TAGCAGCAGGAGAAGGGGGCTGG + Intronic
1183385432 22:37511457-37511479 GAGAAGGAGAAGGAGGAGGCGGG + Intronic
1183482414 22:38072385-38072407 GAGAAGCAGGGCAGGGGGCCTGG - Intronic
1184406784 22:44304955-44304977 GAGCACCAGGAGCAGGGGCCAGG - Intronic
1184550251 22:45200539-45200561 GAGAAGTAGGATGAGGAGCGTGG - Intronic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
1184600212 22:45539056-45539078 GAGGAGGAGGAGAAGGAGAAAGG - Intronic
1184637648 22:45847708-45847730 GTTAAGCAGGAGAAAGAGCAGGG - Intergenic
1184754291 22:46507627-46507649 GCGAGGCAGGAGGAGGAGGCGGG - Intronic
1184857372 22:47153751-47153773 GAGAAGAAGGAGAAGAAACTGGG + Intronic
1184902787 22:47457914-47457936 GAAAAGCAGGAGGAGGAGGAAGG + Intergenic
1184943481 22:47784905-47784927 GGGAAGCAGGGGAGGGTGCCAGG + Intergenic
1185028344 22:48428129-48428151 GTGAAGCAGGATGAGCAGCCTGG + Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1185045136 22:48524950-48524972 AAGAGGCAGGAGAAAGGGCCAGG - Intronic
1185107380 22:48881618-48881640 GTGAGGCAGGAGGAGGAGCTGGG - Intergenic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1185297426 22:50061244-50061266 GAGAGGCAGGAAGAGGAGCTGGG + Exonic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
950045094 3:9944337-9944359 GAGGAGCAAGAGATGCAGCCTGG - Intronic
950360931 3:12448869-12448891 GTGAAGCAGGACAAGGAGAAGGG - Intergenic
950604617 3:14067151-14067173 GAGAAGCAGATTGAGGAGCCAGG - Intronic
950624852 3:14237666-14237688 GAGAAGCTGGAGAGGGAAACTGG - Intergenic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
950962399 3:17119803-17119825 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
951481135 3:23163620-23163642 AAGAAGCGGGAGAGGGAACCAGG - Intergenic
951599741 3:24360476-24360498 GAGAAGCAGGATAGAGAGCAGGG - Intronic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
952649400 3:35707214-35707236 GGGAAGGAGGAGAAGGAGGTTGG - Intronic
952735908 3:36691369-36691391 GGGAGGCAGGAGAAGGAGGAAGG + Intergenic
952819225 3:37471564-37471586 GTGCAGCTGGAGAGGGAGCCAGG + Intronic
952924023 3:38308269-38308291 GAGAAGGAGAAGAAAAAGCCAGG + Intronic
953089786 3:39713317-39713339 GAGAGACAGGAGAGGGAACCGGG + Intergenic
953132555 3:40154252-40154274 GAGCTGCAGGAGAAGGAGAAAGG - Intronic
953151773 3:40331590-40331612 GGGACCCAGGAGGAGGAGCCTGG + Intergenic
953170142 3:40499802-40499824 GAGAAGCAGCAGCAAGAGCATGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953521787 3:43649874-43649896 GACAAACAGGTGCAGGAGCCAGG + Intronic
953626956 3:44579476-44579498 GAGAAGCAAGAGGCAGAGCCGGG - Intronic
953878210 3:46678392-46678414 GGGAGCCAGGAGAAGGAGCAGGG + Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954992766 3:54855290-54855312 GAGAAGCAGGTGCCGGAGCCCGG - Intronic
955219632 3:57012884-57012906 GAGAAGCATGGGCAGGAACCGGG + Intronic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955609460 3:60741676-60741698 GATAAGAAGGAGAAGGAGAAAGG - Intronic
956293834 3:67690924-67690946 AAAAAGCAGGAAAAGGAGCTAGG + Intergenic
956487111 3:69734526-69734548 GATAAGCAGGTGAAGTAGCCAGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
959150402 3:102600555-102600577 GATGAGCAGGTGCAGGAGCCAGG - Intergenic
959352999 3:105291787-105291809 GAAAGTCAGGAGAAGGAGCTGGG - Intergenic
959744359 3:109759408-109759430 GAGAAGGAGGAGGAGGAGACGGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960568286 3:119158090-119158112 AAGAATCAGGGGAAGTAGCCTGG - Intronic
960914023 3:122679468-122679490 GTGAAGGGGAAGAAGGAGCCAGG - Intergenic
961139862 3:124546773-124546795 GAGAAGCAGGTGGAGGAGGCTGG + Intronic
961145117 3:124586750-124586772 GTAAAGCAGGAGAAGGCCCCGGG - Intronic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961376922 3:126473388-126473410 TAGAAGCAGGAGCAGGACCAGGG - Intronic
961390871 3:126551662-126551684 GAGCAGCAAGGGAAGGAGCCAGG - Intronic
961482840 3:127195245-127195267 GAGAAGGAGAGGAAGGTGCCAGG - Intronic
961641357 3:128366536-128366558 GAGGAGGAGGAGCAGGAGCTGGG + Intronic
961645514 3:128390812-128390834 GGAGAGCAGGAGATGGAGCCGGG - Intronic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962200157 3:133394410-133394432 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
962491412 3:135897239-135897261 GAGAAGCAGGAGGAGGAGAGGGG - Intergenic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962741303 3:138364283-138364305 GAGAAGCAGGAGGAGGGACTTGG + Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
963082270 3:141404907-141404929 GAGAAGCAGGGGAAGAAGGTGGG - Intronic
963533231 3:146497300-146497322 GAGAGGCACGGGCAGGAGCCAGG + Intergenic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
963895597 3:150682376-150682398 GAGCAGCAGGAGCACGACCCTGG + Intronic
964669489 3:159209462-159209484 GAGAAGCTGGAGGAGAAGCCAGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
966020525 3:175203305-175203327 AGGAAGCAGCAGAAGGACCCTGG - Intronic
966033360 3:175378201-175378223 GGTAAGCAGGTGCAGGAGCCAGG - Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966979464 3:185117752-185117774 GACAAGCTGGAGAAGTAGGCAGG - Intronic
967146671 3:186612421-186612443 GAGAAGGAAGAGAAGGGGCAGGG + Intergenic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967319131 3:188178273-188178295 GAGAAGCATGAGGAGGGGGCTGG - Intronic
967386617 3:188917889-188917911 GAGAAGCTGAAGAAGGAGCTTGG - Intergenic
967504449 3:190238393-190238415 GAAAAGCAGCAGGAGGAGACAGG + Intergenic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
968288174 3:197520173-197520195 GAGAGGGAGGAGAGGGAGACGGG + Intronic
968811053 4:2799817-2799839 GGGGAGCAGGAGGAGGGGCCAGG + Intronic
969138742 4:5051472-5051494 GGGAAGGAGGGGAAGGAGCGGGG - Exonic
969308705 4:6339906-6339928 GAGAAGCAGAAGAAGGACGATGG + Intronic
969313191 4:6366303-6366325 AAAGTGCAGGAGAAGGAGCCCGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969543501 4:7808814-7808836 GAGAAAGAGGAGCAGGTGCCAGG - Intronic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969854895 4:9991173-9991195 AAGCAGCAGGGGAAGGAGCCAGG - Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970170386 4:13283505-13283527 GAGAGGCCGGAGAAGGTGCCTGG + Intergenic
970380650 4:15503900-15503922 GTTAAGGAGGAGAGGGAGCCAGG + Intronic
970563612 4:17308911-17308933 GTGCAGCTGGAGAAGGTGCCAGG - Intergenic
970621632 4:17827197-17827219 GAGAAGCAGGAGAAAAATCTGGG + Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970779041 4:19713411-19713433 GATAAGTAAGAGAAGAAGCCAGG - Intergenic
970943997 4:21668997-21669019 GAGGAGGAGGAGAAGCAGGCAGG - Intronic
971448690 4:26779516-26779538 GAAAAGAAAGAGAAGGACCCGGG - Intergenic
971793432 4:31198094-31198116 GAGGAGAAGGAGAAGGTACCAGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972081315 4:35153922-35153944 GGGAAGCAAGAAATGGAGCCTGG - Intergenic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
973833774 4:54789102-54789124 GAGAAGGAGGGGAAGGAGAGAGG - Intergenic
974003247 4:56531186-56531208 GAGAAGCAGGAGAGGGGACGAGG - Intronic
974406606 4:61480174-61480196 GAGAAGGAGGAGATGGAGAGAGG - Intronic
974488570 4:62534714-62534736 GAGAAGCCAGCAAAGGAGCCTGG + Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975633136 4:76421451-76421473 GAGAAGCGGCAGAGGGCGCCGGG - Intronic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976132915 4:81904061-81904083 GAGAGGGAGGAGAAGGATACAGG - Intronic
976569785 4:86594624-86594646 AAGGAGCTGTAGAAGGAGCCTGG - Exonic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
976980336 4:91218328-91218350 GAGAGGCACGAGCAGGAACCGGG - Intronic
977135233 4:93295607-93295629 GAGGAGGAGGAGGAGGAGCGGGG - Intronic
977569186 4:98612189-98612211 GAGAAGCAGGAGGAAGAGGAGGG + Intronic
977906450 4:102483138-102483160 GAGAGGCACGAGCAGGAACCAGG + Intergenic
978189856 4:105898144-105898166 AAGAAGCAGAATAAGGAGTCTGG - Intronic
978237933 4:106482604-106482626 GAGGAGCGGGAGAAGGAGGTGGG - Intergenic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
979559559 4:122086961-122086983 GAGAAACAGGAGGAGGAGAAAGG + Intergenic
980412199 4:132435847-132435869 GAGAAGGAGAAGGAGGAGCAGGG - Exonic
980541531 4:134201881-134201903 GAGAAGCAGGAGGCGGTGACTGG + Intergenic
980550273 4:134327075-134327097 GAGAAGCAGCAGCAGGAACGAGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981695892 4:147558411-147558433 GAAAAGCAGGAGGAGGAGGAGGG + Intergenic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
982196943 4:152925910-152925932 GAGAAGGAGAAGAAGAAACCAGG + Intergenic
982325770 4:154126999-154127021 GACAGGCAGGAGCAGGAGCCAGG + Intergenic
982406552 4:155026804-155026826 GAGAAGCAGGGGATAGAGCTGGG - Intergenic
982918418 4:161244354-161244376 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983728040 4:170954431-170954453 GATAAGCAAGAGGAGGAGGCTGG - Intergenic
983826912 4:172273905-172273927 CAGAAGCAAGAGAAGCAGTCAGG + Intronic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984874008 4:184351361-184351383 AAAAAGCAGGAGAAGGAGAGGGG + Intergenic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985149398 4:186930488-186930510 GAGAAGGAGAAGAAGGGGCAAGG - Intergenic
985398568 4:189570988-189571010 GATAAGCAAGAGCAGGAGACTGG + Intergenic
985589375 5:756752-756774 GAGGAGCAGGGGGAGGAGCGAGG + Intronic
985604104 5:849472-849494 GAGGAGCAGGGGGAGGAGCGAGG + Intronic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985868260 5:2533226-2533248 GAGGAGGAGGAGGAAGAGCCTGG + Intergenic
986009734 5:3701177-3701199 GAGAAGGAGGAGAAGAAGGAGGG - Intergenic
986171698 5:5319654-5319676 GGGGAGGAGGAGGAGGAGCCTGG - Exonic
986200116 5:5572024-5572046 GAGAACCAGGAGAAGAAGCATGG - Intergenic
986584340 5:9299255-9299277 GAGTAGGTGAAGAAGGAGCCTGG + Intronic
986815733 5:11407988-11408010 GGGAGGCAGGAGAAGGAGATTGG + Intronic
986853996 5:11847476-11847498 GGGAAGGAGGAGGAGGAGGCAGG + Intronic
987039603 5:14049527-14049549 GAGAGGCAGCAGGAGCAGCCAGG + Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989539914 5:42606504-42606526 AAGAAAGAGGAGAAGGTGCCAGG + Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990592581 5:57281418-57281440 TAGAAGCAGAAGAGGGAGGCAGG + Intergenic
990597900 5:57329633-57329655 GGGAAGAAGGAGAAGGGGCGAGG + Intergenic
990618528 5:57533366-57533388 GAGCAACAGGTGAAGGAACCTGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991294171 5:65063189-65063211 GAGATGCTGGAGAAGGAGATAGG - Intergenic
991298045 5:65102244-65102266 GAGAGGCAGGAAATGGTGCCTGG + Intergenic
992025347 5:72664228-72664250 GACAAGCTGGAAAAGGAGCAGGG - Intergenic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
994507071 5:100656765-100656787 GAGAGGCAGGAGCGGGATCCGGG + Intergenic
995033448 5:107506561-107506583 GATGAGCAGGAGCAGGAGCAGGG + Intronic
995679908 5:114704647-114704669 GAGAAGCGTGAGCAGGAACCGGG - Intergenic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
995877459 5:116805542-116805564 TAGAAGCACTAGAAGGAGCTCGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996903799 5:128575053-128575075 AAAAAGCATGACAAGGAGCCTGG + Intronic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997329303 5:133047548-133047570 GAGAAGCACAGGCAGGAGCCGGG + Intergenic
997713142 5:136022857-136022879 GGGAAGCTGGAGAGGGAGCCAGG + Intergenic
997721129 5:136079243-136079265 GGCAAGCAGGAGAAGGACCTTGG - Intergenic
998225960 5:140326412-140326434 AAGAAGCAAGACAAGGAGCTGGG - Intergenic
998295656 5:140966828-140966850 GAGAGGCAGTAGCAGCAGCCAGG - Exonic
998367620 5:141641079-141641101 GGGAATCAGGAGCTGGAGCCAGG - Exonic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998785834 5:145707864-145707886 GACAAGAAGGAGAGAGAGCCTGG + Intronic
998791186 5:145767428-145767450 TGGATGCAGGACAAGGAGCCGGG + Intronic
998800005 5:145859647-145859669 GAGAGGCAGGAGGAGGAGAAGGG + Intergenic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
998978317 5:147672768-147672790 GAGAAACAGGTGAAGCATCCTGG + Intronic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999203507 5:149832803-149832825 GCCAAGGAGGACAAGGAGCCGGG + Exonic
999241718 5:150131867-150131889 GAGGAGTGGGAGAGGGAGCCTGG - Intronic
999868927 5:155729681-155729703 TAGAAGCAGCAGAGGCAGCCCGG - Intergenic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1000963663 5:167629880-167629902 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002003531 5:176213413-176213435 GAAAAGCAGGACAAGGAGAAAGG + Intergenic
1002222927 5:177697503-177697525 GAAAAGCAGGACAAGGAGAAAGG - Intergenic
1002861362 6:1082389-1082411 CAGAACCAGGAGCAGGACCCAGG + Intergenic
1003311164 6:4971037-4971059 GACAAGGACCAGAAGGAGCCTGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003778313 6:9394604-9394626 GAGAAACAGGAGAGGGAGCATGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003880606 6:10476618-10476640 GAAAAGCAGCTGAGGGAGCCTGG + Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004510454 6:16280048-16280070 GAGAAGGAGAAGGAGGAGCAAGG + Intronic
1005111924 6:22291663-22291685 GAGAAGGAGGAGAAAGAGAAAGG - Intronic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1005817367 6:29565471-29565493 GAGAAGTAGGAGGCAGAGCCTGG - Intronic
1005824896 6:29626924-29626946 TAGAAGGATGAGAAGGAGTCAGG + Intronic
1005856400 6:29866401-29866423 GAGATGCGGGAGGAGGAGCAGGG - Intergenic
1005883016 6:30074714-30074736 GAGGAGCGGGAGCAGGAGGCTGG - Intronic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1006012472 6:31054346-31054368 GAGAAGCAGGAGCAGCAGAAGGG - Intergenic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1006113823 6:31764576-31764598 AAGAAACAGAAAAAGGAGCCTGG - Exonic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1006378739 6:33685666-33685688 GAGTAGCGGGATGAGGAGCCAGG - Exonic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006433788 6:34015332-34015354 GGGAAGCAGGGAGAGGAGCCTGG - Intergenic
1006435318 6:34023047-34023069 GAACAGCAGGAGAAGCAACCGGG - Intronic
1006572497 6:35017483-35017505 GAGCAGCAGCAGCCGGAGCCAGG + Exonic
1006793455 6:36718001-36718023 GAGGAGCAGGAGTTGGGGCCAGG - Intronic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1007476612 6:42123740-42123762 TAGAAGCAGGGATAGGAGCCAGG - Intronic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008381004 6:50839941-50839963 GAGAGGCAGGAAAAAGAGACAGG + Intronic
1008484569 6:52021763-52021785 GAGAAGGAGGGGAAGGAGGAGGG - Intronic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009905676 6:69867518-69867540 GAGAACCAGGAGGCGGCGCCGGG + Intronic
1010980502 6:82364692-82364714 GAGGAGCGGGAGCAGGAGCGCGG + Exonic
1011398737 6:86937464-86937486 GAGGAGCAGGAGCAGGAGCATGG - Exonic
1011900697 6:92292226-92292248 GAGGAGCATTAGAAGGATCCAGG - Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012472727 6:99589461-99589483 GAGAAGCTGGAGGAGGACCGGGG + Intergenic
1012671989 6:102064239-102064261 GAGAAGGAGGAGAAGAAGAAAGG - Intronic
1012720523 6:102736750-102736772 GAGAAGGGGGATAAGGAGCTTGG + Intergenic
1013215908 6:108027161-108027183 GAGAAGCAGTAGAGGAAGCCTGG + Intergenic
1013304685 6:108837511-108837533 GAGAAACAGAAAAAGGAGACAGG + Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014470808 6:121812474-121812496 GAGAAGCTGAAAAAGCAGCCAGG + Intergenic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1014663498 6:124204084-124204106 GAGCAGCAGGATAAGGATGCTGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014802320 6:125790896-125790918 GAGGAGCAAGAGGAGGAGGCGGG - Exonic
1015388331 6:132651695-132651717 GAGAGACAGGAGAAGAAGCAGGG - Intergenic
1015625955 6:135181323-135181345 GAGAAGGAGGAGGAGGAAACAGG - Exonic
1015664003 6:135606672-135606694 GAGAAGCAGGACTAGGAGTTAGG - Intergenic
1015694987 6:135970243-135970265 GAAAAGCAGGATAAGGGGACAGG + Intronic
1015765380 6:136710707-136710729 GAGAAGCAGGAATAGGAACCAGG + Intronic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1015984594 6:138872495-138872517 GAGAAGCAGAAAGAGGAGTCTGG - Intronic
1016301128 6:142632937-142632959 GAGAAGGGGGAGAAGGCTCCAGG + Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016779667 6:147943897-147943919 GAGAGCCAGGAAAAGGGGCCAGG - Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016880300 6:148904989-148905011 GACTAGGAGGAGTAGGAGCCGGG - Intronic
1017027148 6:150191239-150191261 GCAACGCAGGAAAAGGAGCCAGG - Intronic
1017164207 6:151391740-151391762 GAGCAGCAGGAGGCGGAGGCGGG - Intergenic
1017339551 6:153305136-153305158 GAGGAGGAAGAGGAGGAGCCAGG - Intergenic
1017351528 6:153448275-153448297 GAGAATCATGTGAAGGAGTCTGG - Intergenic
1017437443 6:154429713-154429735 GAGAAGGAGGAGGAGGAGACGGG - Intronic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018038028 6:159898485-159898507 GAGGAGGAGGAGGAGGAGTCTGG - Intergenic
1018201489 6:161399493-161399515 GATGAGCAGGTGCAGGAGCCAGG - Intronic
1018505751 6:164466082-164466104 GAGGAGTAGGAGGAAGAGCCAGG - Intergenic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1019004907 6:168788913-168788935 GGGAAGCAGGACAAGCAACCGGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019378873 7:711321-711343 GAGAAGCTGGAGAAGGTGAGTGG - Exonic
1019497703 7:1348094-1348116 GGGAAGGAGAAGAGGGAGCCGGG + Intergenic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019631509 7:2052142-2052164 GAGAAGCGAGAGCAGGAGCAGGG + Intronic
1019729533 7:2622623-2622645 GAGGAGGAGGAGGAGGAGCTGGG - Intergenic
1019834661 7:3370868-3370890 GAGGAGCAGGTGAGGGACCCAGG - Intronic
1019943397 7:4308539-4308561 CAGAAGCTGGAGAGGGACCCGGG - Intergenic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1022282015 7:28920453-28920475 GAGACGCAGGAGAAGGAGATGGG - Intergenic
1022591866 7:31671326-31671348 GATGAGCAGGTGCAGGAGCCAGG - Intergenic
1022790735 7:33686557-33686579 TAGAAACAGGAGAATGGGCCTGG + Intergenic
1023000441 7:35801884-35801906 GAGAGGCGGGAGGAGGAGCGGGG - Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1023564353 7:41508681-41508703 TAGAAGCTGGAGAAGCAGCATGG - Intergenic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1023695107 7:42837450-42837472 GAGAAGCAGCATAAGGACCACGG - Intergenic
1023864657 7:44233032-44233054 GAGCAGCTGGGGGAGGAGCCTGG + Intronic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024522180 7:50315073-50315095 CAGAAGCCGGACTAGGAGCCGGG - Intronic
1024580017 7:50793549-50793571 GAGGAGCAGGAAAAGTAGCCGGG - Intergenic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1025911568 7:65832814-65832836 GAGAAGTAGGAGAGGAGGCCAGG + Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026955052 7:74371751-74371773 GAGAGGGAGGAGAAGGAGAGAGG + Intronic
1026975941 7:74498467-74498489 GAGAAGCAAGGGAAGAAGCTTGG - Intronic
1027043536 7:74976527-74976549 GAGGAGGAGGAGGAGGAGACAGG - Intronic
1027080110 7:75225832-75225854 GAGGAGGAGGAGGAGGAGACAGG + Intergenic
1027342341 7:77222758-77222780 GAGAAACTGGAAATGGAGCCTGG - Intronic
1027575138 7:79922135-79922157 AACAAGCAGGAGAGGGAGCCTGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1029259522 7:99292372-99292394 GAGCAGCTGGAGGAGGAGCAGGG + Intergenic
1029424371 7:100486990-100487012 GAGTGGCAGGAGAGGGAGCGTGG - Exonic
1029495546 7:100894167-100894189 GAGGAGGAGGAGAAGGAGTGGGG + Exonic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029745105 7:102512261-102512283 GAGAAGGAGGGGGAGGAGACAGG + Intronic
1029763097 7:102611422-102611444 GAGAAGGAGGGGGAGGAGACAGG + Intronic
1029859201 7:103551198-103551220 GAGGGGCAGCAGAAGGTGCCAGG + Exonic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030095535 7:105895208-105895230 GAGAAGCAGGTGCAGGAGAAGGG + Intronic
1030207696 7:106966820-106966842 GAGAAGCAGGGGATGGAGTGGGG + Intergenic
1030320750 7:108164573-108164595 GAGGAGCAGGAGCAGGAGCAGGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031300092 7:120054240-120054262 GGGAAACAGGAGAAGGGGCTGGG + Intergenic
1031796204 7:126176992-126177014 GAGGAGGAGGAGAAGGAGAAGGG - Intergenic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032159689 7:129501244-129501266 AAGAAGCAGGAGTAGGGTCCTGG - Intergenic
1032523167 7:132561500-132561522 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
1032523313 7:132562093-132562115 GAGAAGGAGGAGGAGGAGAAAGG - Intronic
1032523480 7:132562846-132562868 GAGAAGGAGGAGGAGGAGAAAGG - Intronic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1032917849 7:136511661-136511683 GAGGAGCTGGAGAGGGAGGCTGG + Intergenic
1033023825 7:137753960-137753982 GAGGAGGAGGAGGAGGAGCGTGG + Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033539107 7:142339373-142339395 TAGAAGCAGCAGAAAGTGCCTGG - Intergenic
1033741587 7:144280039-144280061 GAGAAGCAGGAGACAGAAGCAGG + Intergenic
1033741590 7:144280084-144280106 GAGAAGCAGGAGACAGAAGCAGG + Intergenic
1033752311 7:144369530-144369552 GAGAAGCAGGAGACAGAAGCAGG - Intronic
1033752315 7:144369575-144369597 GAGAAGCAGGAGACAGAAGCCGG - Intronic
1034346472 7:150388389-150388411 GAGAAGCAGAAGAAAGAGAATGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034696131 7:153055608-153055630 GGGAAGCAGAAGGAGGAGCTGGG - Intergenic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1034903077 7:154919928-154919950 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1035151223 7:156874362-156874384 GAGAGGCACGAGCGGGAGCCGGG - Intronic
1035370403 7:158376150-158376172 GATAGGCAGGTGCAGGAGCCGGG - Intronic
1035389905 7:158497119-158497141 GGGAAGGAGGAGAGGGAGCAGGG - Intronic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1035722842 8:1805158-1805180 GAGAAGCAGGAGCAGCAGCTGGG - Intergenic
1035744065 8:1948887-1948909 GATAAGGAGGAGAAGAACCCAGG - Intronic
1036059634 8:5301486-5301508 GGGAAGGAGAAGAAGGTGCCAGG + Intergenic
1036298356 8:7553770-7553792 GAGGAGCTGAAAAAGGAGCCAGG - Intergenic
1036299661 8:7561420-7561442 GAGGAGCTGAAAAAGGAGCCAGG - Intergenic
1036300965 8:7569066-7569088 GAGGAGCTGAAAAAGGAGCCAGG - Intergenic
1036324219 8:7767248-7767270 GAGGAGCTGAAAAAGGAGCCAGG + Intergenic
1036453955 8:8892517-8892539 GAGAGGCAGGAGAGGGAGTCAGG + Exonic
1036597495 8:10227156-10227178 GAGGAGCAGATGAAGGAGCTTGG + Intronic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037563097 8:20092391-20092413 GATGAGCAGGAGAAGGTGCATGG - Intergenic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1037655440 8:20879695-20879717 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037918608 8:22788102-22788124 GAGAACCAGGAGCAGCAGGCAGG + Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038035251 8:23681945-23681967 GAGAGGCGGGAGAGGGAGGCAGG + Intronic
1038139484 8:24827687-24827709 GAGAAGGAGGACAAGGAAGCTGG + Intergenic
1038313410 8:26463141-26463163 GAGAAGGAGGAGGAGGAGAACGG - Intronic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038638241 8:29304255-29304277 GAGAGGCACGAGCAGGAACCGGG + Intergenic
1038960850 8:32517954-32517976 GAGAAACAGGAGAAGAAAACAGG + Intronic
1038963704 8:32548852-32548874 GAGGAGCAGGAGGAGGATCGTGG - Intronic
1039111276 8:34043050-34043072 GAGGAGGAGGAGAATGTGCCAGG + Intergenic
1039177916 8:34830082-34830104 GAGCTGCAGGATAAGCAGCCCGG + Intergenic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039808509 8:41024065-41024087 GAGCAGCAGGAGGAGGTGCCAGG - Intergenic
1040517067 8:48144038-48144060 GAGAAGCAAGAGAAGCAGTCAGG + Intergenic
1040522910 8:48193234-48193256 GAGGAGGAGGAGCAGGAGCTGGG + Intergenic
1040834986 8:51722310-51722332 GACGAGCAGGTGCAGGAGCCAGG + Intronic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1042107924 8:65348588-65348610 GGGCAGCAGGAGCAGGAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042437596 8:68785338-68785360 GATAAGCAGGGGAAAGAGACTGG - Intronic
1042601398 8:70502912-70502934 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1043015982 8:74940921-74940943 AATAAGCAGCAGAAGTAGCCAGG - Intergenic
1043384370 8:79733366-79733388 GAGAAGTAGAAGAGGGAGCCAGG + Intergenic
1044216408 8:89616286-89616308 GAGAAGCAGCAGATGGACCATGG + Intergenic
1044362523 8:91304874-91304896 AAGCAGCATGAGAAGGGGCCTGG - Intronic
1044584014 8:93852141-93852163 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1044857712 8:96493716-96493738 GAGGAGAAGGAGGAGGACCCGGG + Exonic
1044941322 8:97347188-97347210 GAGAGGGAGGAGGAGGATCCAGG + Intergenic
1045015596 8:97998997-97999019 GAGATGGAGGAGGAGGAGCTGGG - Intronic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045462704 8:102440208-102440230 GAAAAGCAGGAGAAAGGGCCTGG - Intergenic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045862561 8:106829530-106829552 GAGAAGCTGAAGGAGGAACCTGG - Intergenic
1045933704 8:107655607-107655629 GAGAAGCAAGGGCAGGAGCTGGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046582566 8:116111148-116111170 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
1046584049 8:116129678-116129700 GAGAAGAGGGAGAAGGGGCTGGG + Intergenic
1046612884 8:116445248-116445270 AAGAAGCAGGAGGAGGAGAGAGG + Intergenic
1046902006 8:119533862-119533884 GAGAAGTTGTAAAAGGAGCCAGG + Intergenic
1047054891 8:121153022-121153044 GAGGAGGAGGAGGTGGAGCCAGG - Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1047250088 8:123175411-123175433 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1047541222 8:125768486-125768508 GAGAAGGAGGAGGAGGACCCAGG + Intergenic
1047817609 8:128482036-128482058 GAGGAGCATGAGCAGGAGACTGG - Intergenic
1048267352 8:132999179-132999201 GAGAAGGACGAGCAGGAGTCTGG + Intronic
1048329621 8:133463045-133463067 GAGAAGCAGGAGGTGCAGCCTGG + Intronic
1048340710 8:133536614-133536636 GAGCTGCAGGAACAGGAGCCAGG - Intronic
1048417573 8:134243687-134243709 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048873267 8:138816162-138816184 GGGAAGGAGAAGAAGGAGACAGG + Intronic
1049334607 8:142076533-142076555 GAGGGTCATGAGAAGGAGCCGGG - Intergenic
1049684118 8:143932455-143932477 GAGAAGGAGGAGGAGGAGGTGGG - Exonic
1049777282 8:144412610-144412632 GTGCAGCAGGAAGAGGAGCCAGG + Exonic
1049852533 8:144840742-144840764 GAGAAGCAGGGGAGGTGGCCAGG + Intronic
1049976546 9:865560-865582 GAGGAGCAGATGAATGAGCCCGG + Intronic
1050257533 9:3810751-3810773 GACAACCAGGAAAAGAAGCCTGG - Intergenic
1050624399 9:7487634-7487656 GAGAAGGTGGAGAATGAGACTGG + Intergenic
1050733242 9:8733808-8733830 GAGGAGCAGCAGCAGCAGCCTGG + Exonic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051383263 9:16480510-16480532 GAGAGGCGGGAGCAGGAACCGGG + Intronic
1051667428 9:19478193-19478215 GAGACTCAGGGGAAGGAACCGGG + Intergenic
1052738435 9:32369648-32369670 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053272171 9:36757869-36757891 GGCAAGGAGGTGAAGGAGCCTGG - Intergenic
1053434938 9:38068455-38068477 GAGAAGCAGGAGGCGGTGGCCGG + Exonic
1053479117 9:38402953-38402975 GAGGAGCAGGAGGAAGACCCAGG + Intergenic
1054437419 9:65225348-65225370 GAGCAGCAGCAGAAGCTGCCAGG + Intergenic
1054736168 9:68752538-68752560 AAGAAGGAAGAGAAGGAGCAAGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055353712 9:75416185-75416207 GAGAAGTAAGAGAACCAGCCTGG + Intergenic
1055379034 9:75685980-75686002 GAGGAGGAGGAGAAGGAGTTGGG + Intergenic
1055770576 9:79712773-79712795 GAGTAGCAGGTGAAGGAGAAGGG - Intronic
1056261885 9:84857008-84857030 GAGAATCAGAGGAAGGAGCTGGG - Intronic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1057043177 9:91862360-91862382 GAGCAGCAGGAGCAGCAGCCAGG + Intronic
1057181525 9:93033294-93033316 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181534 9:93033317-93033339 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057222061 9:93262785-93262807 GGGAAGCAGCAGCAGGAGCCAGG - Intronic
1057497373 9:95571852-95571874 GAGAAGGAGGAGGAGGAGAGGGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057619146 9:96619540-96619562 CAGGAGCCGGAGGAGGAGCCCGG + Exonic
1057897977 9:98924805-98924827 GAGCATCAGGAGAGGGTGCCAGG + Intergenic
1058047661 9:100373912-100373934 GGGAGGCAGGAGAGGGAGACTGG - Intergenic
1058848226 9:108983433-108983455 GAGAAGCAGCTGAGTGAGCCAGG - Intronic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059203379 9:112440321-112440343 GAGAGGCAGGAGACCGAGGCAGG + Intronic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059350635 9:113662460-113662482 GGGGGGCAGGAGAAGGAGGCAGG - Intergenic
1059421743 9:114196533-114196555 CAGAAGCAGGAGTAGGACCCAGG - Intronic
1059981379 9:119775887-119775909 GAGGAGCAGGAGAAAGAACCTGG - Intergenic
1060044988 9:120332807-120332829 AAAGAGCAAGAGAAGGAGCCAGG + Intergenic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1060309056 9:122442969-122442991 GACAAGTAGGAGAAGCATCCTGG - Intergenic
1060315677 9:122508161-122508183 GAGAAGGAGAAGAAGGAGAAGGG + Intergenic
1060481453 9:124018721-124018743 GAAAAGAAAGCGAAGGAGCCAGG - Intronic
1060510778 9:124230380-124230402 AAGAAGGAGGAGAAGGCACCTGG - Intergenic
1060626748 9:125120395-125120417 GAAAAACAGGAGGAAGAGCCAGG + Intronic
1060892382 9:127197008-127197030 GCAAAGCAGGAGAGGCAGCCAGG + Intronic
1061061290 9:128251573-128251595 GAGCAGCTGGGGAAGCAGCCTGG + Intronic
1061242695 9:129383580-129383602 AAGAAGCAGGAAAAGGAACTGGG + Intergenic
1061267017 9:129512135-129512157 GAGGAGTTGGAGAAGGAGCCAGG - Intergenic
1061613637 9:131764783-131764805 GAGAAGGAGGAGGAGGAGAGAGG - Intergenic
1061675273 9:132212116-132212138 GGAAAACAGGAGAAGGAGCAGGG - Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061842651 9:133368338-133368360 GAGCAGCAGGAGGAGGCCCCAGG + Intronic
1061959561 9:133981103-133981125 GAGAAGCAGGAGACGGGGTGAGG + Intronic
1061967595 9:134025104-134025126 GAGGAGCAGGAGGAGGAGCTGGG - Intergenic
1062043715 9:134415666-134415688 GACCAGGAGGAGAAGGGGCCTGG + Intronic
1062066028 9:134526829-134526851 GAGAAGGAGAAGACAGAGCCGGG + Intergenic
1062074761 9:134579826-134579848 GAGGAGGGGGAGAAGGAGCGGGG + Intergenic
1062098936 9:134717982-134718004 CAGCAGCATGAGAAGCAGCCTGG + Intronic
1062168012 9:135118087-135118109 GAGAAGGAGCTGAAAGAGCCAGG - Intronic
1062255831 9:135620123-135620145 GAGAAGGGGGAGAAGGAGTAGGG - Intergenic
1062344592 9:136109063-136109085 GAGAAGCAGGGGCAGGAGGCAGG - Intergenic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062542598 9:137048269-137048291 GAGGAGGAGGAGGAGGAGCACGG + Exonic
1062542730 9:137048735-137048757 GAGCAGCAGGAGGACGACCCAGG + Exonic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1062719188 9:138026322-138026344 GAGAATCAGGTGAGGGAGCTGGG - Intronic
1203772629 EBV:57415-57437 GCTGAGCAGGAGGAGGAGCCGGG + Intergenic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185688323 X:1948429-1948451 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185688601 X:2133951-2133973 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1185917634 X:4053485-4053507 GAGAAGCAGGAGGAAGAGGATGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185982842 X:4798690-4798712 GACAAGCAGGTGCAGGAGCTGGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1186830279 X:13383295-13383317 GAGAAGGAGGAGAGGAGGCCTGG + Intergenic
1186862683 X:13689153-13689175 GAGCAGCTGGAGCGGGAGCCTGG + Exonic
1187107559 X:16259946-16259968 GAGAAGCTGGACAAGGACCCAGG + Intergenic
1187293914 X:17980943-17980965 GAGAGGCAGGAGAAGGGGCAGGG - Intergenic
1187293950 X:17981069-17981091 GAGAGGGAGGGGAAGGAGCAGGG - Intergenic
1187435131 X:19260969-19260991 GAGAACCAGGAGAAGGGCCTGGG - Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1188993292 X:36850978-36851000 GAGAAGGAGGAGGAGGAGAAAGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189959200 X:46308303-46308325 GAGCAGCAGGAGCAGCAGCTAGG - Intergenic
1190084226 X:47381229-47381251 GAGGAGCAGGAGGAGGAGCAGGG + Intronic
1190161327 X:48033509-48033531 GAGAAGCAGAAAAAGAGGCCAGG - Intronic
1190259842 X:48790908-48790930 GAGAAGGAGGGGAAGGAGAGGGG + Intronic
1190937887 X:55013039-55013061 GAGGAGAATGAGAAGCAGCCAGG - Intronic
1191618676 X:63192929-63192951 GAGAGGCAGGAGCGGGAACCTGG - Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192177904 X:68897414-68897436 GAGCAGCAGGGAAGGGAGCCAGG - Intergenic
1192320038 X:70083401-70083423 GAGAAACAGTTGAAGGAGCTGGG + Intergenic
1192533647 X:71910810-71910832 GGGGAGGAGGAGGAGGAGCCCGG + Intergenic
1192885010 X:75327838-75327860 GAGGAGGAGGAGGAGGACCCGGG - Intergenic
1194537632 X:95125622-95125644 GAGAAGGAGGAGAAGGAAAGAGG + Intergenic
1194566846 X:95499567-95499589 GAGGAAGAGGAGAAGGAGCGAGG - Intergenic
1194763014 X:97816697-97816719 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1194927009 X:99837018-99837040 AGGAAGCAGCAGAAGGACCCTGG - Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1196817171 X:119674585-119674607 GAGAAGCAGGGGGAGGAACAAGG + Intronic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1196900033 X:120373895-120373917 GTGGAGCAGGAGGAGGAGGCGGG - Intronic
1197706533 X:129638553-129638575 TAGAAGCCCGAGAGGGAGCCAGG + Intergenic
1197779079 X:130141711-130141733 GTGAATCAGGAGGAGTAGCCAGG - Intronic
1197906082 X:131427282-131427304 GAGAAGCAGGAGGAGGAGAGAGG - Intergenic
1197906098 X:131427352-131427374 GAGAAGGATGAGAAGGAGGAAGG - Intergenic
1198147087 X:133868249-133868271 GACAGGCAGGAGCAGGAGCTAGG - Intronic
1198496229 X:137196298-137196320 GAGGGGCAGGAGCAGCAGCCAGG - Intergenic
1198957477 X:142148583-142148605 GAGGAGGAGGAGCAGGAGCTTGG + Intergenic
1199028840 X:142972496-142972518 GAGAGGCACGAGCAGGAACCGGG - Intergenic
1199819301 X:151428833-151428855 CAGAAGCAGGAAGAGTAGCCAGG - Intergenic
1199850525 X:151722467-151722489 GAGAAGCAGGAGGCTGGGCCAGG - Intronic
1199976961 X:152899786-152899808 TGGAAGCAGGAGGAGGAGCTCGG + Intergenic
1200076825 X:153555300-153555322 GACACGCAGGAGTGGGAGCCAGG - Intronic
1200142319 X:153908328-153908350 GAGGAGCAGGAGCGGGAGCCAGG - Intronic
1200150892 X:153950940-153950962 AAGAAGCAGGAGCTGCAGCCAGG - Exonic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200767711 Y:7094373-7094395 GAGAAGCCAGTGATGGAGCCTGG - Intergenic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic
1202124790 Y:21557891-21557913 GAGAAGCCTGACATGGAGCCTGG - Intergenic
1202154218 Y:21871489-21871511 GAGAAGCCTGACATGGAGCCTGG + Intergenic
1202168873 Y:22020040-22020062 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202222488 Y:22566328-22566350 GGGAATCAGGAGAATGGGCCTGG + Intergenic
1202271527 Y:23078699-23078721 GAGAGGCAGGGGTGGGAGCCAGG - Intergenic
1202294499 Y:23341983-23342005 GAGAGGCAGGGGTGGGAGCCAGG + Intergenic
1202320627 Y:23629332-23629354 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202368422 Y:24182194-24182216 AAGCAGCTGGGGAAGGAGCCTGG - Intergenic
1202424522 Y:24712443-24712465 GAGAGGCAGGGGTGGGAGCCAGG - Intergenic
1202446267 Y:24957642-24957664 GAGAGGCAGGGGTGGGAGCCAGG + Intergenic
1202502363 Y:25487923-25487945 AAGCAGCTGGGGAAGGAGCCTGG + Intergenic
1202550140 Y:26040724-26040746 GGGAATCAGGAGAATGGGCCTGG + Intergenic