ID: 1076802099

View in Genome Browser
Species Human (GRCh38)
Location 10:132835578-132835600
Sequence CGTCTCCACAGCATGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076802099_1076802110 25 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802110 10:132835626-132835648 GATGGGCCTCCTGGGCCCCAGGG 0: 1
1: 0
2: 3
3: 28
4: 340
1076802099_1076802108 17 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802108 10:132835618-132835640 AGGCAGCGGATGGGCCTCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 198
1076802099_1076802109 24 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802109 10:132835625-132835647 GGATGGGCCTCCTGGGCCCCAGG 0: 1
1: 0
2: 0
3: 48
4: 447
1076802099_1076802107 16 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802107 10:132835617-132835639 CAGGCAGCGGATGGGCCTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 227
1076802099_1076802105 7 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802105 10:132835608-132835630 ATCATTGCGCAGGCAGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 51
1076802099_1076802106 8 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802106 10:132835609-132835631 TCATTGCGCAGGCAGCGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1076802099_1076802102 -3 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802102 10:132835598-132835620 ACGCTGCCACATCATTGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 30
1076802099_1076802104 3 Left 1076802099 10:132835578-132835600 CCTGGTCCCATGCTGTGGAGACG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1076802104 10:132835604-132835626 CCACATCATTGCGCAGGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076802099 Original CRISPR CGTCTCCACAGCATGGGACC AGG (reversed) Intronic
900347460 1:2216506-2216528 TGTCTCCCTAGCCTGGGACCTGG + Intergenic
900360112 1:2284267-2284289 CGTCTCGGCAGCATGGGTCCAGG - Intronic
901491714 1:9600038-9600060 CGTCTGCACAGCAAGGCACCAGG - Intronic
902943184 1:19814987-19815009 TGGCTCCACAGAATGTGACCTGG - Exonic
903883971 1:26530550-26530572 CGTCTCCACAGCCTGGGGTAGGG - Intronic
906274244 1:44504452-44504474 CATATTCAGAGCATGGGACCTGG + Intronic
907372752 1:54013853-54013875 CATCTCCACCACAGGGGACCGGG - Intronic
913195189 1:116450438-116450460 CATTTACTCAGCATGGGACCTGG + Intergenic
919667101 1:200302594-200302616 CCTGTCCGGAGCATGGGACCTGG + Intergenic
1062910142 10:1206859-1206881 CGTCTCCACAGCATCTGGGCCGG + Intronic
1067055310 10:43046454-43046476 CTTCCTCACAGCATGGGACCAGG - Intergenic
1067261518 10:44697279-44697301 CGTGTCCACAGCAGGGAACATGG - Intergenic
1068041194 10:51826315-51826337 TGTATGCACAGCATGGGATCTGG - Intronic
1069097659 10:64279075-64279097 CTTCCCCACAGCATGGCAACTGG + Intergenic
1071734339 10:88281541-88281563 CGTGTGCAAAGCCTGGGACCAGG - Intronic
1076134725 10:128037433-128037455 TGTCTCCAGAGCATGGGAGTGGG + Intronic
1076802099 10:132835578-132835600 CGTCTCCACAGCATGGGACCAGG - Intronic
1078444491 11:11393988-11394010 CGTCTCCACCGCTTGGCATCAGG - Intronic
1082759099 11:57109186-57109208 AGTTTCCAGAGCATGGCACCAGG - Intergenic
1083983124 11:66190898-66190920 CGCCTCCTCAGCCTGTGACCTGG - Intronic
1087882539 11:103434839-103434861 GGGCTCCACAGCATGGTAACTGG + Intronic
1089975396 11:122727612-122727634 CGTCTTGACACCACGGGACCTGG + Intronic
1090873773 11:130770865-130770887 CGTCTCCACTGCAGGGGTCTGGG - Intergenic
1092274324 12:7047889-7047911 CTTCCCCACAGCATGGCATCTGG + Intronic
1093005720 12:14048669-14048691 TGTCTCCATAGCAAGGGATCTGG + Intergenic
1094762234 12:33547358-33547380 CGCCTCCACAGCCTGCGCCCTGG + Intergenic
1096106644 12:48999886-48999908 TCTCTCCACCGCATGGGAGCTGG - Intergenic
1096524203 12:52200949-52200971 TGTCTCCACAGCTTGGGGCGGGG + Intergenic
1096684092 12:53276539-53276561 GGGCTCCTCAGCATGGGAGCAGG + Intronic
1097052459 12:56231455-56231477 CTTCTCCACAGCCTGGGGCTAGG + Exonic
1106656849 13:31755725-31755747 CTTCTCCACTGCATGGCACTGGG - Intronic
1108857927 13:54819230-54819252 TCTCTCCACACCATGGGGCCAGG - Intergenic
1114269196 14:21090944-21090966 CGTCTCCGCAGCCTGCGACCTGG - Exonic
1117029129 14:51651545-51651567 CGTCTCCACAGCAGGGGGAAAGG + Intronic
1119281167 14:73409337-73409359 CTTCTTCACAGCATGGTGCCTGG - Intronic
1119332113 14:73802634-73802656 TGTAACCAAAGCATGGGACCGGG + Intergenic
1127671258 15:61197356-61197378 CTTCTCCACACCATGGGAACGGG - Intronic
1131652974 15:94422199-94422221 CCTGTCCACAGCATGGGTCTTGG + Intronic
1131932130 15:97454618-97454640 CCTAACCACAGCATGGGACAGGG - Intergenic
1132676451 16:1123190-1123212 CTGCCCCACAGCCTGGGACCTGG - Intergenic
1132999175 16:2840631-2840653 AGTCTGGACAGCATGGGTCCTGG + Intergenic
1136927470 16:34388471-34388493 CTTCTCCCCAGTGTGGGACCGGG + Intergenic
1136977104 16:35023335-35023357 CTTCTCCCCAGTGTGGGACCGGG - Exonic
1142420743 16:89967972-89967994 TGGTCCCACAGCATGGGACCAGG + Exonic
1144850622 17:18242257-18242279 CCAGCCCACAGCATGGGACCTGG + Exonic
1146653610 17:34622345-34622367 AGTCTCCTCAGCATTGGAGCAGG - Intronic
1146932793 17:36789973-36789995 CCTCTGCACAGCATGGCTCCTGG + Intergenic
1151785480 17:76272967-76272989 CATCTCCCCAGCATGGGAAAGGG - Intergenic
1152657487 17:81526809-81526831 CGTCTCCCCAGGATGGTGCCTGG + Intergenic
1153479268 18:5530689-5530711 CTTCTCCACCGCATGGCTCCTGG + Intronic
1160298187 18:77656432-77656454 TGTCTCCACATCATATGACCAGG - Intergenic
1161571997 19:5035822-5035844 CCCCTCCACAGCATGGGACCCGG - Intronic
1164905604 19:31964984-31965006 GGTCACCACAGCATGGGATTTGG - Intergenic
1166346006 19:42166282-42166304 TGTCCCCAGAGCATGAGACCTGG - Intronic
1167144694 19:47674759-47674781 TGTCTTCACAGCATGGCAGCTGG + Intronic
1167217288 19:48173064-48173086 CCAGCCCACAGCATGGGACCTGG - Intronic
928399619 2:30968477-30968499 TGTCCCCACAGCATGGCAGCTGG - Intronic
930546857 2:52778950-52778972 CTTCTCCACAACATGGCACCTGG - Intergenic
934986779 2:98893222-98893244 CTTCACCACATCATGGGACAAGG + Intronic
935402494 2:102674872-102674894 CATCTCCAAAGCATGAAACCAGG + Intronic
936483686 2:112908289-112908311 TGTGTCCACAGCACGGGACAGGG - Intergenic
938381846 2:130840749-130840771 TGTCTCCACAGCCTGCCACCAGG - Intronic
945305407 2:208254891-208254913 CCCCTCCACAGCCAGGGACCGGG + Intronic
947224707 2:227828734-227828756 TCTCTCTACACCATGGGACCAGG + Intergenic
948591001 2:239050079-239050101 CTTCTCCACAGCAAGCGTCCAGG - Exonic
1170725472 20:18922436-18922458 CATCTTCACAGCATGGCAGCTGG - Intergenic
1175245455 20:57579405-57579427 CGTCTCCACAGCAGGGGCTGGGG + Intergenic
1176194024 20:63828803-63828825 CGGCTCCACAGCCTGAGAACTGG - Intronic
1178621804 21:34183685-34183707 CCTCTCCACAGAATGGGCTCAGG + Intergenic
1178626511 21:34223119-34223141 CGTCCCAACTGCACGGGACCTGG + Intergenic
1181173503 22:21023271-21023293 GGTCTCCAAGGCATTGGACCTGG - Exonic
1182458632 22:30468947-30468969 CTTCTCCACAGAAAGGGACACGG - Intronic
1183304739 22:37076544-37076566 CATCTCCAGGGCATGGGCCCAGG + Intronic
1184549705 22:45197973-45197995 GGCCCCCACAGCATGGGACGCGG + Intronic
1185421891 22:50739333-50739355 AGGCTGCACAGCATGGGGCCTGG + Exonic
951881191 3:27483420-27483442 CTTCTCCACTGGCTGGGACCCGG - Intronic
955938079 3:64121718-64121740 TGTCTGCCCAGCATGGGACTAGG - Intronic
956639091 3:71397833-71397855 TGTCTGTACAGCTTGGGACCTGG - Intronic
961868979 3:129974790-129974812 GGGCTCCACAGGATGGGTCCGGG - Exonic
962610543 3:137072732-137072754 CCTCTCCATAGCAGGGGATCAGG - Intergenic
962618142 3:137149140-137149162 TGACTGCACAGCATGGGAGCAGG - Intergenic
972272462 4:37524457-37524479 CATCTCCACAGCATGGCAGCTGG + Intronic
985647780 5:1093220-1093242 CCTCTCCACAGCAGGGGATGGGG + Intronic
992368115 5:76114067-76114089 CGTCTGCAAAGCATGAGAACTGG - Intronic
1000335378 5:160238056-160238078 CAGCTCCACAGCATGGAGCCTGG + Intronic
1003502028 6:6710890-6710912 TATATCCAGAGCATGGGACCAGG + Intergenic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007520867 6:42451389-42451411 CCTCTCCCCAGCAGGGAACCTGG + Intronic
1015440701 6:133242470-133242492 CTTCTCCAAAGGAAGGGACCTGG + Intronic
1015748897 6:136540264-136540286 AGTCTCCAGAGCCAGGGACCTGG + Intronic
1017243386 6:152196017-152196039 CGACTCCTCAGCCTGGGACAGGG - Intronic
1017699635 6:157055928-157055950 TGTCTCCACAACATGGCAGCAGG + Intronic
1018185400 6:161262084-161262106 CATCACCACAGCCTGGGCCCTGG + Intronic
1018214987 6:161518176-161518198 TGACTCCACACCATGGGGCCGGG + Intronic
1019062229 6:169264830-169264852 AGTGTCCACAGCACAGGACCAGG - Intergenic
1019270158 7:142483-142505 AGAGTCCACAGCATGGGACCTGG + Intergenic
1023780177 7:43647849-43647871 GGCCCCCACAGCATGGGTCCTGG - Intronic
1028872145 7:95781738-95781760 AGTCTCCAGAGCATGTGCCCTGG - Intronic
1034312263 7:150099298-150099320 CCTCTCCACAGGATGGTAACAGG + Intergenic
1034794589 7:154001360-154001382 CCTCTCCACAGGATGGTAACAGG - Intronic
1045334956 8:101192735-101192757 CATTTCCACAGCAAGAGACCAGG + Intronic
1047132651 8:122038249-122038271 GCTCTCCACAGCATGAGCCCTGG - Intergenic
1049342205 8:142119111-142119133 CTTCTCCCCAGAATGGCACCAGG - Intergenic
1049344639 8:142131921-142131943 CATCTCCACAGCATGGCCTCCGG - Intergenic
1049763094 8:144339585-144339607 CCTTTCCACAACATGGGGCCTGG - Intergenic
1049958243 9:712886-712908 CGTCTCCACAGTCTGGGTGCTGG - Exonic
1055524123 9:77112994-77113016 CTTCCCCACAGCAAGGGACTTGG - Intergenic
1059640940 9:116216431-116216453 CGTATCAACAGCATGGGGACTGG + Intronic
1060746010 9:126131373-126131395 CACCTTCTCAGCATGGGACCTGG - Intergenic
1061135399 9:128730597-128730619 GCTTTCCACAGCCTGGGACCTGG + Exonic
1061222970 9:129262953-129262975 CGTCTCCACAGGACTGGGCCAGG + Intergenic
1062417951 9:136462861-136462883 CGCCTCCTCATCATGGCACCTGG - Intronic
1062509381 9:136896385-136896407 CGTCTCCACAGCCTCACACCCGG - Intronic
1185478328 X:428295-428317 TTTCTGCACAGCTTGGGACCCGG - Intergenic
1190916340 X:54813987-54814009 CAACTCCCCAGCATGGTACCTGG - Intronic
1195883841 X:109620035-109620057 AGACCTCACAGCATGGGACCAGG - Intergenic
1200907355 Y:8497675-8497697 TGTCTCCACTGGATGGGTCCAGG - Intergenic