ID: 1076802291

View in Genome Browser
Species Human (GRCh38)
Location 10:132836146-132836168
Sequence CACCGCCTGCACCTTTCCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076802287_1076802291 -10 Left 1076802287 10:132836133-132836155 CCTGCTCACCTCCCACCGCCTGC 0: 1
1: 0
2: 4
3: 49
4: 691
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802279_1076802291 6 Left 1076802279 10:132836117-132836139 CCCCCTCCCCTGCAGCCCTGCTC 0: 1
1: 1
2: 16
3: 163
4: 1321
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802286_1076802291 -9 Left 1076802286 10:132836132-132836154 CCCTGCTCACCTCCCACCGCCTG 0: 1
1: 0
2: 4
3: 53
4: 525
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802275_1076802291 12 Left 1076802275 10:132836111-132836133 CCCCCTCCCCCTCCCCTGCAGCC 0: 1
1: 5
2: 41
3: 491
4: 4090
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802273_1076802291 19 Left 1076802273 10:132836104-132836126 CCCTGCTCCCCCTCCCCCTCCCC 0: 1
1: 16
2: 169
3: 1054
4: 6954
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802277_1076802291 10 Left 1076802277 10:132836113-132836135 CCCTCCCCCTCCCCTGCAGCCCT 0: 1
1: 1
2: 24
3: 283
4: 2120
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802285_1076802291 -2 Left 1076802285 10:132836125-132836147 CCTGCAGCCCTGCTCACCTCCCA 0: 1
1: 0
2: 4
3: 74
4: 814
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802281_1076802291 4 Left 1076802281 10:132836119-132836141 CCCTCCCCTGCAGCCCTGCTCAC 0: 1
1: 0
2: 8
3: 101
4: 799
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802282_1076802291 3 Left 1076802282 10:132836120-132836142 CCTCCCCTGCAGCCCTGCTCACC 0: 1
1: 0
2: 10
3: 114
4: 838
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802272_1076802291 23 Left 1076802272 10:132836100-132836122 CCTGCCCTGCTCCCCCTCCCCCT 0: 1
1: 1
2: 45
3: 430
4: 4179
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802278_1076802291 9 Left 1076802278 10:132836114-132836136 CCTCCCCCTCCCCTGCAGCCCTG 0: 1
1: 4
2: 22
3: 257
4: 1888
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802276_1076802291 11 Left 1076802276 10:132836112-132836134 CCCCTCCCCCTCCCCTGCAGCCC 0: 1
1: 3
2: 44
3: 376
4: 2878
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802274_1076802291 18 Left 1076802274 10:132836105-132836127 CCTGCTCCCCCTCCCCCTCCCCT 0: 2
1: 55
2: 605
3: 2065
4: 9156
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802271_1076802291 26 Left 1076802271 10:132836097-132836119 CCGCCTGCCCTGCTCCCCCTCCC 0: 1
1: 4
2: 41
3: 453
4: 3282
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802283_1076802291 0 Left 1076802283 10:132836123-132836145 CCCCTGCAGCCCTGCTCACCTCC 0: 1
1: 0
2: 6
3: 117
4: 852
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802284_1076802291 -1 Left 1076802284 10:132836124-132836146 CCCTGCAGCCCTGCTCACCTCCC 0: 1
1: 0
2: 3
3: 90
4: 719
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1076802280_1076802291 5 Left 1076802280 10:132836118-132836140 CCCCTCCCCTGCAGCCCTGCTCA 0: 1
1: 0
2: 7
3: 104
4: 934
Right 1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG 0: 1
1: 0
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076802291 Original CRISPR CACCGCCTGCACCTTTCCTT TGG Exonic
901927959 1:12579001-12579023 CAACCCCTCCACCTTTCTTTCGG + Intronic
903259053 1:22121429-22121451 CACCTCCTGCACCTACCCTGTGG + Exonic
907875816 1:58486894-58486916 CACCACATGCCCCTTTCCTTAGG - Intronic
911085279 1:93972070-93972092 TAAAGCCTGCACCTTTCCCTGGG + Intergenic
913075683 1:115338685-115338707 CATCGGCTGCTCCTTTTCTTCGG + Intergenic
919283258 1:195518925-195518947 CACCTCCTGCTCCCTTCCCTGGG + Intergenic
919909503 1:202102065-202102087 CGCAGCTTGCACCATTCCTTTGG + Intergenic
922796589 1:228342557-228342579 TGCCGCCTGGACCTTTCCCTAGG - Intronic
923547457 1:234933132-234933154 CATCCCCGGCCCCTTTCCTTTGG - Intergenic
924073150 1:240304437-240304459 TTCAGCCTGCACCTTTCCCTGGG + Intronic
1064497428 10:15927445-15927467 CTGAGCCTGCACCTTTCCATGGG + Intergenic
1066029368 10:31403067-31403089 CAAAGCCTGCACCTTTTCTATGG - Intronic
1074405901 10:113180286-113180308 TACCTCCTGCCCCTTTCCATGGG + Intergenic
1075672658 10:124273098-124273120 CACTGCCTGCCCCTCTCCTGAGG + Intergenic
1075930130 10:126288660-126288682 CACCGCATGATCCTGTCCTTAGG - Intronic
1076802291 10:132836146-132836168 CACCGCCTGCACCTTTCCTTTGG + Exonic
1079414790 11:20223673-20223695 CATGGCCTGCACCTTTGGTTTGG - Intergenic
1081706442 11:45184572-45184594 TACCTCCTGCTCCCTTCCTTAGG - Intronic
1082760368 11:57121501-57121523 AACCCCCTGCTCCTATCCTTGGG + Intergenic
1085364744 11:75929442-75929464 CAGCGACTGCACCCTTCCTTTGG - Intronic
1085833252 11:79925645-79925667 CACCACCTGTCCCTTTCTTTCGG - Intergenic
1087123127 11:94595436-94595458 CACCGCATGCATCCTTCCTGGGG + Intronic
1089865236 11:121626039-121626061 CACTGCCTGCCACTTCCCTTGGG + Intronic
1090052645 11:123393572-123393594 CACCGCGTGCATCTTTCCTTGGG + Intergenic
1093264198 12:16982264-16982286 CTGAGCCTGCACCTTTCCCTGGG + Intergenic
1095487814 12:42702862-42702884 CACCCTCTTCACCTATCCTTTGG - Intergenic
1104799752 12:131546644-131546666 GACCAGCTGCCCCTTTCCTTTGG + Intergenic
1106422277 13:29594760-29594782 CGCCGCCTGCACCTCTCGTCTGG - Intronic
1107447151 13:40479680-40479702 CACCCCCTGCTCTTTTCATTCGG + Intergenic
1113461889 13:110487965-110487987 CACAGGCTGCACCTTTGTTTAGG - Intronic
1113589289 13:111486958-111486980 CACCGCATGCACCCTCCCTGAGG + Intergenic
1114947333 14:27700387-27700409 CACAAGCTGCACCCTTCCTTAGG - Intergenic
1117336709 14:54762278-54762300 CAATGCCAGCACTTTTCCTTTGG + Intronic
1119391151 14:74291972-74291994 CTCTCCCTGCCCCTTTCCTTGGG - Intronic
1120852025 14:89180153-89180175 AACCGCATGAACCCTTCCTTGGG - Intronic
1121228285 14:92337644-92337666 CACACCCTGCCCCTTTCCTTGGG - Intronic
1121655906 14:95595347-95595369 CACGGCCTGCTCCTTCCCCTCGG + Intergenic
1123797134 15:23783404-23783426 CACCACCTGGTCCTTACCTTAGG - Intergenic
1124461609 15:29897241-29897263 CACGGCCTGAACCGTACCTTAGG - Intronic
1124621488 15:31276573-31276595 CACCACCTGCACATATGCTTAGG - Intergenic
1128751118 15:70149885-70149907 CCTCCCTTGCACCTTTCCTTAGG - Intergenic
1128769571 15:70271758-70271780 CAGTGCCTGCACCTGTCCTGAGG - Intergenic
1129595281 15:76959139-76959161 CACTGCCTGCATTTGTCCTTAGG + Intergenic
1130114943 15:80998704-80998726 CACTGCCTCCACCTTTCTTTAGG - Intergenic
1130448317 15:84025324-84025346 CACCACCTGCACAGTTCCATTGG - Exonic
1130653798 15:85777712-85777734 CACCGCCTGACCCGTTCCTCTGG - Intronic
1132485435 16:187990-188012 CACCGCGTCCCCCTTTACTTTGG + Intergenic
1132641218 16:979464-979486 CAGCGCCTGCTCCTTTCCCCAGG - Intronic
1136499435 16:30662697-30662719 CACCGCCTCCACCGGTCCCTCGG + Exonic
1140816721 16:78628037-78628059 CACACCCTGTATCTTTCCTTGGG - Intronic
1141264973 16:82488490-82488512 CACTGCCGGGTCCTTTCCTTGGG + Intergenic
1144659494 17:17058888-17058910 CCCCTTCTGCACCTTTGCTTGGG - Intronic
1145904641 17:28509425-28509447 CACCTCCTGCTCCATTCCTCAGG + Intronic
1146689685 17:34864930-34864952 CACCACCTTCACCTTTGCTCTGG + Intergenic
1148754589 17:49966227-49966249 CACCACGTCCACCTTTCCTGAGG + Intergenic
1149639799 17:58195215-58195237 CACCCCCAGCACCTTGCCTTTGG - Intronic
1152783038 17:82234827-82234849 CACCCCCACCCCCTTTCCTTGGG - Exonic
1153424207 18:4944942-4944964 CACCCCCTGCCCCTGCCCTTGGG + Intergenic
1155433119 18:25782783-25782805 CACCGTGTTCTCCTTTCCTTTGG + Intergenic
1157108169 18:44794147-44794169 CACCAGCAGCACCTTTCCCTTGG + Intronic
1164483770 19:28637372-28637394 CAAAGCCTGCTCATTTCCTTCGG - Intergenic
1167665966 19:50823010-50823032 CACCACATGCTCCTTTCCTTGGG - Intronic
925793564 2:7518716-7518738 CACCACCTGCACCTGCCCTGAGG - Intergenic
926060286 2:9800872-9800894 CACCAGCTGCACCGTCCCTTGGG - Intergenic
926290753 2:11527796-11527818 GGCCTCCTGCACTTTTCCTTTGG - Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
929399205 2:41560575-41560597 AACCACCTGAACCTTTCCTATGG + Intergenic
930670569 2:54146045-54146067 CCTCTCATGCACCTTTCCTTCGG - Intronic
931746764 2:65297809-65297831 CACTGTCTGCACCTTGCTTTTGG + Intergenic
937718026 2:125057393-125057415 CATCTCCACCACCTTTCCTTGGG + Intergenic
942713778 2:178868057-178868079 CACAGACTGGCCCTTTCCTTAGG - Exonic
948403722 2:237702404-237702426 CACAGCCTGGCCCTTTCCCTGGG - Intronic
1173402277 20:42736264-42736286 CACATGCTGCTCCTTTCCTTTGG - Intronic
1174404293 20:50293718-50293740 CACCGCCCTCACCTTGCCCTGGG - Intergenic
1175751568 20:61501732-61501754 CACTGCCTCCACCATTCGTTAGG + Intronic
1176242555 20:64081775-64081797 CACCCCCTGCGCCTTTTCATGGG + Intronic
1178422795 21:32455700-32455722 CACCACCTGCACCATTCCACGGG + Intronic
1179708599 21:43196617-43196639 CACGGCCTGCAGCTGTCTTTAGG + Intergenic
1183463056 22:37964340-37964362 CTCCACCTGGACCTTTCCTTGGG - Intronic
1184074405 22:42167005-42167027 CACTGCCTGCTCCTTTTCCTGGG - Intronic
950103466 3:10373338-10373360 CACAGCCTGGACCTTTCTATTGG + Intronic
953342796 3:42149743-42149765 CACCTCCTCCACCATGCCTTTGG - Intronic
954610297 3:51941579-51941601 CACCGCCTTCCCCATTCCTGGGG - Intronic
955458213 3:59149171-59149193 CACAGCCTGCAGCTGTGCTTTGG + Intergenic
959578210 3:107957701-107957723 CTCCTCCTCCTCCTTTCCTTGGG - Intergenic
961820166 3:129571807-129571829 CATCGCCTGCACCATGCCTGAGG - Exonic
963761979 3:149293686-149293708 TACTGCATGTACCTTTCCTTTGG - Intergenic
969846538 4:9924308-9924330 CTCCGCCTGCGGCTTTCCCTGGG + Intronic
976501240 4:85791864-85791886 GACCACCTCCACCTTTACTTGGG - Intronic
977027289 4:91834973-91834995 CACTGCCAGCACCTTAACTTTGG - Intergenic
981049701 4:140298029-140298051 CTCCCCCAGCCCCTTTCCTTGGG + Intronic
981768663 4:148281171-148281193 CACAGTCTGCTCCTCTCCTTTGG - Intronic
981964337 4:150582457-150582479 TACCTCCTGCACCTTCCATTTGG + Exonic
985520238 5:370743-370765 CAACACCTGCACCTTCCCATGGG - Intronic
985879566 5:2628165-2628187 CACCTCCTGCTCCTCTCCTCAGG - Intergenic
988839856 5:35072776-35072798 CATTGCTTGCACCTTTTCTTTGG + Intronic
989643081 5:43602677-43602699 CTCCGCCTGCCCCTTTCCCTTGG + Intronic
995950000 5:117700609-117700631 CACTGCCTGTGCTTTTCCTTCGG + Intergenic
996400896 5:123061394-123061416 CCTCCCCTGCACCTTTTCTTAGG + Intergenic
997583119 5:135029387-135029409 CACCGCCTGGAGCCTTCCGTCGG + Intronic
1000149110 5:158482198-158482220 CACAGCCCACACCTCTCCTTTGG + Intergenic
1003023669 6:2534271-2534293 CCCTGCCTGCACCTTTACCTTGG - Intergenic
1003109086 6:3238556-3238578 CACAGCCTCCACCATTCCTTCGG + Intronic
1006178065 6:32135332-32135354 CAGCTCCTGAACCTCTCCTTGGG - Intergenic
1007240176 6:40419242-40419264 CATTCCCTGCACCTTGCCTTTGG + Intronic
1007921628 6:45615506-45615528 CACCTCCTGGAGCTTTCCTAGGG - Intronic
1007952922 6:45888129-45888151 CACAGCCTGCCCCTTCCCTGGGG + Intergenic
1011720343 6:90149772-90149794 CACAGCCTGCATCTTTCACTGGG + Intronic
1019412838 7:914104-914126 CACAGCCTGCACCTTGGCTGTGG - Intronic
1021215777 7:17913438-17913460 CACCGCCTCCACCTCTGCTGAGG + Intronic
1022438208 7:30410188-30410210 AAGCCCTTGCACCTTTCCTTGGG + Intronic
1028728858 7:94121869-94121891 CATACTCTGCACCTTTCCTTTGG + Intergenic
1032779047 7:135147694-135147716 CACCTCCTACTCATTTCCTTGGG - Intronic
1033254882 7:139791680-139791702 AGCCGCCTGCACCTTTCACTAGG - Intronic
1034281381 7:149856816-149856838 CCTCCCCTGCACCCTTCCTTAGG - Intronic
1037960187 8:23091959-23091981 CAGCACCTACACCTTTCCCTTGG + Intronic
1037971877 8:23177766-23177788 CAGCACCTGCACCTTTCTTCTGG - Intergenic
1040021383 8:42744472-42744494 ACCTGCCAGCACCTTTCCTTGGG - Intergenic
1046773922 8:118143968-118143990 CCCCGCCAACACCTTTACTTTGG - Intergenic
1049645278 8:143733328-143733350 CACGGCCTGGACCCTTCCCTGGG - Intronic
1050512810 9:6412996-6413018 CACCGCCTGCACCTGGCCACTGG - Intergenic
1051253955 9:15192487-15192509 CTCATCCTGAACCTTTCCTTGGG - Intronic
1055399543 9:75908474-75908496 CACTGCCTCCCCCTTTCCTCTGG + Intronic
1056547816 9:87627557-87627579 CTCTGTCTGCATCTTTCCTTTGG - Intronic
1057880169 9:98787199-98787221 CACAGCCTGCACCCTACCTGGGG + Intronic
1060044472 9:120328813-120328835 TACCTCCTGCCCCTTCCCTTTGG + Intergenic
1061522803 9:131130778-131130800 CACTGCCAGCTGCTTTCCTTTGG - Exonic
1189109114 X:38268661-38268683 CAGCCCCTACTCCTTTCCTTAGG - Intronic
1189458457 X:41216222-41216244 CACCATCTCCACCATTCCTTTGG - Exonic
1190060263 X:47206314-47206336 CACCACCTGCACATTGCCTTTGG - Exonic
1191250469 X:58257772-58257794 CATCACCTGCACCTGGCCTTCGG + Intergenic
1195755175 X:108192645-108192667 CAGCTCCTGCACCTCTTCTTGGG - Intronic
1199245059 X:145594026-145594048 CACTGCCAGGACATTTCCTTTGG + Intergenic
1200067343 X:153510177-153510199 TACCGCCTGTGACTTTCCTTCGG + Intergenic
1200083564 X:153591701-153591723 CACCACCTGCACACTGCCTTGGG + Intronic