ID: 1076802423

View in Genome Browser
Species Human (GRCh38)
Location 10:132836702-132836724
Sequence GTCCCAGGCCTCCCTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 391}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076802408_1076802423 24 Left 1076802408 10:132836655-132836677 CCGGTGTCTGTCCGGCACCTTCT 0: 1
1: 0
2: 3
3: 10
4: 164
Right 1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG 0: 1
1: 0
2: 3
3: 56
4: 391
1076802407_1076802423 25 Left 1076802407 10:132836654-132836676 CCCGGTGTCTGTCCGGCACCTTC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG 0: 1
1: 0
2: 3
3: 56
4: 391
1076802411_1076802423 13 Left 1076802411 10:132836666-132836688 CCGGCACCTTCTTGGGACTGTCC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG 0: 1
1: 0
2: 3
3: 56
4: 391
1076802415_1076802423 -8 Left 1076802415 10:132836687-132836709 CCGGGCGTTTCCCGAGTCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG 0: 1
1: 0
2: 3
3: 56
4: 391
1076802414_1076802423 7 Left 1076802414 10:132836672-132836694 CCTTCTTGGGACTGTCCGGGCGT 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG 0: 1
1: 0
2: 3
3: 56
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076802423 Original CRISPR GTCCCAGGCCTCCCTGGGGT GGG Intronic
900097835 1:947534-947556 GGCACAGGCCTCCCTGAGGCTGG + Intronic
900150999 1:1179373-1179395 GGCCAAGGCCTCCCTGGGACGGG + Intronic
900186643 1:1336107-1336129 GCCCCAGCCCTGCCTGAGGTGGG - Exonic
900265437 1:1754756-1754778 CCCACTGGCCTCCCTGGGGTGGG - Intronic
900275795 1:1826648-1826670 ATCCCAGGGCTCACTTGGGTGGG - Intronic
900414198 1:2527657-2527679 CACCCAGGCCTCCCTGGGGCAGG - Intergenic
901754818 1:11435084-11435106 GAGCCTGGCCTCCCTTGGGTAGG - Intergenic
902393357 1:16118987-16119009 ATCCCACCCCTGCCTGGGGTGGG - Intergenic
902513104 1:16976695-16976717 GTCTGGGGCCTACCTGGGGTTGG + Exonic
902550175 1:17214685-17214707 GCCCCAGGCCACCCTGCAGTGGG - Intronic
902837707 1:19057824-19057846 TTCCCAGCCTGCCCTGGGGTGGG - Intergenic
903189387 1:21648280-21648302 GGCTTAGGGCTCCCTGGGGTGGG + Intronic
903741920 1:25563217-25563239 GTCCCACTCCTGCCTGGGCTGGG + Intronic
905678272 1:39845748-39845770 GTCCAAGGCCATGCTGGGGTGGG + Intronic
905792932 1:40799725-40799747 GTCCCAGGCCTCCCTCGTGGAGG - Intronic
906346134 1:45015754-45015776 GTCCCAGAACTACATGGGGTAGG + Intergenic
906529824 1:46517318-46517340 GTCCCCTGCCTCCCTGGGAGGGG + Intergenic
907490870 1:54807994-54808016 TTCCGAGGACTCACTGGGGTAGG + Exonic
908262141 1:62347479-62347501 GACCCAGACCTCCATGGGGCTGG + Intergenic
912246245 1:107964792-107964814 GTCCCAGGTCACCCGGTGGTTGG + Exonic
914248946 1:145906406-145906428 GTGCCAGGCTTCCCTGAGGCTGG + Exonic
915457131 1:156048422-156048444 GGCCCAGGTTTGCCTGGGGTGGG + Intronic
920313558 1:205062287-205062309 GTTCCAGGCAGCCCTGAGGTAGG + Intronic
922152382 1:223017306-223017328 GGCCCCGGCCTGCCTGTGGTGGG - Intergenic
922336476 1:224622626-224622648 TTTCAAGGCCTCACTGGGGTTGG + Intronic
922797963 1:228350948-228350970 GGCCCAGGCCTGCCCGGGGATGG + Intronic
923678570 1:236100857-236100879 CTCCCAGCCCTCCCAGAGGTGGG - Intergenic
923725695 1:236503441-236503463 GGCCCAGGCATCCCAGGGGAGGG - Intergenic
924763172 1:247007801-247007823 GCCCCGGGCCTCCCGGCGGTCGG - Intronic
1063370989 10:5523203-5523225 TGGCCAGGACTCCCTGGGGTAGG - Intergenic
1064031506 10:11885989-11886011 GTCCCAGGCCTCCCACAGTTCGG - Intergenic
1064350544 10:14572449-14572471 GTCTCAGGCCTCCATGCTGTAGG - Intronic
1065053635 10:21820677-21820699 GGCCCAGGCTTCCATCGGGTTGG - Intronic
1065907623 10:30272221-30272243 GTTCCAGGCGCCACTGGGGTGGG - Intergenic
1066656539 10:37703242-37703264 GTGACAGCCCTCCCTGGGCTTGG - Intergenic
1067752144 10:48978496-48978518 TTCCTAGGCCTCCCTAGGCTGGG - Intronic
1067850087 10:49749257-49749279 GGCCCAGGCCTCCCAGGGAGGGG + Intronic
1067855052 10:49784800-49784822 GGCCCAGGCCTGCATGGGGAAGG - Intergenic
1068030283 10:51698045-51698067 GTCCCAGGCATTTCAGGGGTGGG - Exonic
1069581882 10:69572239-69572261 GGCCCAGGCCTCCACGGGGGCGG - Exonic
1069798284 10:71067054-71067076 GTCCCCTGCCTCCCTGGGGGAGG + Intergenic
1070481486 10:76887299-76887321 GTCCCGGGACTCCCTGGACTTGG + Exonic
1070824267 10:79381683-79381705 TTCCTTGGCCTCCCTGGGGTGGG + Intergenic
1070914519 10:80144457-80144479 GCCCCAGCGCTCCCTGGGGACGG + Intronic
1075040650 10:119104427-119104449 GTCCCCGGGCTCCCTCGGGCCGG - Intronic
1075397647 10:122139532-122139554 GTCCCAGGCCTCCGTGGGACTGG + Intronic
1075785703 10:125048635-125048657 GGCCCCTGGCTCCCTGGGGTCGG - Intronic
1075903874 10:126064288-126064310 GGCCCAGGGCTCCATGGGGAAGG - Intronic
1076334251 10:129694368-129694390 GTCTCAGCCCTCCCAGGGGAAGG - Intronic
1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG + Intronic
1076821543 10:132942355-132942377 GTCCGGGGCCTCCCCGGGGCGGG + Intronic
1076844394 10:133061879-133061901 GTCGCAGGCCCTCCTGGGGGTGG + Intergenic
1077154011 11:1083534-1083556 GGACCAGGCCTCCCAGGGGCAGG + Intergenic
1077343780 11:2037323-2037345 GTCCCCAGCCTGTCTGGGGTGGG - Intergenic
1077385684 11:2268591-2268613 GTGACAGCCCACCCTGGGGTGGG - Exonic
1077530933 11:3094444-3094466 GACACAGGCCTCCCAGGGATCGG - Intronic
1078434616 11:11314133-11314155 TTCCCAGGCCTCTCTGGCCTTGG - Intronic
1078567984 11:12433734-12433756 GGCCCCGGCCTCTCTGGGTTTGG + Intronic
1080933322 11:36836909-36836931 TTCCCAGGCCTACCTGGTGCAGG + Intergenic
1081531115 11:43959937-43959959 GTCCCAAGCCTCCTGTGGGTTGG - Intergenic
1081590882 11:44422290-44422312 GTCCCAGCTCTCCCTGAGGGGGG + Intergenic
1081690376 11:45073994-45074016 GCCCCAGAGCTCCCTGGGTTGGG + Intergenic
1083421604 11:62556416-62556438 GACTCAGGCCTCCCTGGGGCAGG + Intergenic
1083660767 11:64250963-64250985 GCGCCCGGCCTCCCTGGGCTAGG + Intergenic
1083713997 11:64565356-64565378 GTCCCAGCCCTGCCTTGGGGAGG - Intronic
1083724224 11:64619972-64619994 CTCCCATGAGTCCCTGGGGTGGG - Intronic
1084178115 11:67433915-67433937 GTCCCAGGGCTAGCTGGAGTAGG - Intronic
1084274336 11:68043951-68043973 GCCCCCGGCCTCCCGGAGGTGGG + Intronic
1084437590 11:69153267-69153289 GCCACAGGCCTTCGTGGGGTGGG + Intergenic
1084526407 11:69701090-69701112 GTCCCAGCCATCCGTGGGCTCGG - Intronic
1084578442 11:70006395-70006417 GTCCAGGGACTGCCTGGGGTGGG + Intergenic
1084709633 11:70835982-70836004 GTCTCAAGCCACACTGGGGTGGG + Intronic
1084953368 11:72678782-72678804 GTCTCAGCCTGCCCTGGGGTTGG - Intergenic
1084979507 11:72821774-72821796 GCCCCGGGCCTCCCTGAGGTGGG - Intronic
1085347369 11:75776872-75776894 TTCCTAGACCTCCCTGGGGCTGG + Intronic
1085641988 11:78198370-78198392 GTGTCAGGCGTCCTTGGGGTTGG + Intronic
1085726581 11:78960246-78960268 TTCTCAGTGCTCCCTGGGGTGGG - Intronic
1087976656 11:104557516-104557538 GTCACAGGCCACCTTGGGGTTGG + Intergenic
1088805726 11:113350364-113350386 GACCCGGGCCTCCATGGGTTTGG + Intronic
1089297421 11:117478395-117478417 ATCTCAGGGCTCCCTGAGGTTGG - Intronic
1089557414 11:119321854-119321876 GTCCCAGGCATCGCCGGGATGGG - Intergenic
1089981603 11:122777226-122777248 GAGCCAGGCTTCCCAGGGGTGGG - Intronic
1090413245 11:126523335-126523357 GGGGCAGGCCTCCCTGGGGGTGG + Intronic
1090717099 11:129440417-129440439 CTCCCAGGCCTCCCTGGAGACGG - Intronic
1202826766 11_KI270721v1_random:92512-92534 GTCCCCAGCCTGTCTGGGGTGGG - Intergenic
1091871199 12:3892641-3892663 TTCCCAGGCCTCCCTGAAGCAGG + Intergenic
1092531656 12:9350139-9350161 GTCCCAAGCCTCCCGGGCGAAGG - Intergenic
1094502526 12:31033947-31033969 GTCCCAAGCCTCCCGGGCGAAGG - Intergenic
1096706378 12:53424846-53424868 GTCCCAGGGCTCCCTGGAGGAGG - Exonic
1100621585 12:96281158-96281180 GTTCCAGGACTTTCTGGGGTTGG + Intronic
1101606222 12:106248629-106248651 CTCCCAGCCCGCCATGGGGTTGG + Intronic
1101628069 12:106465618-106465640 CACCGAGGCCTGCCTGGGGTGGG - Intronic
1102132501 12:110542972-110542994 CTTCCAGGCCTCCCTGGGGAGGG + Intronic
1102708335 12:114902637-114902659 GTCCAAGGGCTACATGGGGTGGG - Intergenic
1104262060 12:127193710-127193732 CTGCTAGGCCTCACTGGGGTGGG + Intergenic
1104889277 12:132132579-132132601 CCCCCAGGCCTTCCTGGAGTGGG + Intergenic
1104953631 12:132453539-132453561 GACCCAGACCTCCCTGGAGCTGG - Intergenic
1105520422 13:21126185-21126207 TTTCGAGGGCTCCCTGGGGTTGG - Intergenic
1105547550 13:21361887-21361909 TGCCCAGGTCTCCATGGGGTGGG + Intergenic
1105708240 13:22981949-22981971 GCCCCGGGCCCCCCTGGGCTGGG - Intergenic
1106283685 13:28300282-28300304 GTCACAGGTGTCCCTGGGGGTGG - Intergenic
1107978528 13:45713346-45713368 GTCCCAGGCCGACCTGGAGCTGG + Exonic
1113716694 13:112514274-112514296 GTTTCAGGCATCCATGGGGTGGG + Intronic
1113788671 13:113016052-113016074 CTCCCAGGCACCGCTGGGGTGGG - Intronic
1114263330 14:21055560-21055582 TTCCCAGGCCTCCCTGAGTGAGG + Intronic
1116764231 14:49051112-49051134 GTCCCAGGTCTCCCAGGAGTAGG - Intergenic
1117650508 14:57900033-57900055 TTCCCAAGCCTCCCTGCGATTGG + Intronic
1117882750 14:60328060-60328082 GCCCTAGGCTTCGCTGGGGTGGG + Intergenic
1118888679 14:69888506-69888528 GTCCCAGTGCTCCCTGGTGGTGG - Intronic
1119032740 14:71205230-71205252 GCCCCAGGTTTCCCTGAGGTAGG - Intergenic
1119330493 14:73789791-73789813 GTCCCAGGCAGCCCTGGTATTGG + Intronic
1119759553 14:77141191-77141213 GGCCGAGGGCTCTCTGGGGTGGG - Intronic
1119805380 14:77478669-77478691 GTCCCTGGTCTCCCTGCAGTGGG - Exonic
1119898739 14:78242644-78242666 GTCCCTGGCCTCCCTGGCTGGGG + Intronic
1120466044 14:84859074-84859096 GTGCCAGGCCTACATGGGGCTGG + Intergenic
1120663498 14:87278642-87278664 CTCCCTGGCCTCTCTGGGCTGGG + Intergenic
1121320542 14:92989265-92989287 ATCCCAGGCCTCCCTGGGGATGG - Intronic
1121437609 14:93929375-93929397 GGCCCTGGCCTGCCTGGGGAGGG - Exonic
1122078971 14:99253946-99253968 GTTTCAGGCCTCTCTGGGGATGG - Intronic
1122443997 14:101755835-101755857 TTCCCAGGCCTCACTGGGCAGGG - Intergenic
1122694813 14:103547385-103547407 GTCCCAGGCTTCCCCTGGGTTGG - Intergenic
1122775332 14:104114452-104114474 GTCCCGGGGCTCCCTGTGGTAGG - Exonic
1123026265 14:105425759-105425781 GGCCCCAGCCTCCCTGGGCTTGG - Intronic
1123043303 14:105499382-105499404 GGCACAGGCCTCCCTGGAGCGGG + Intronic
1123412624 15:20072914-20072936 GTACCAGGCCACCCATGGGTGGG + Intergenic
1123521966 15:21080027-21080049 GTACCAGGCCACCCATGGGTGGG + Intergenic
1124258815 15:28167990-28168012 GTCCTAGGCCTGACTGGGGGTGG - Intronic
1125592683 15:40864594-40864616 GTCCCAGGTGTCCCTGGGTGGGG + Intergenic
1126741546 15:51781565-51781587 GTACCAGGCTTGCCTGGGGCAGG + Intronic
1128247079 15:66140456-66140478 GGCCCAGGCCTGCCTGAGGAGGG - Intronic
1128383313 15:67129127-67129149 TTCCCAGGGGTCCCAGGGGTTGG - Intronic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1129231879 15:74201526-74201548 TTCTCAGGCCACCCTGGGGCGGG + Intronic
1129320318 15:74771062-74771084 GTCCCAGGCTTACCTAGGGCTGG - Intergenic
1129483268 15:75843988-75844010 GTCCCAGCCCGGCCTGGGATGGG - Intronic
1130910074 15:88264855-88264877 ATCCCAGAACTCCCTGGGCTGGG - Intergenic
1131281052 15:91021899-91021921 GTGCCAGGCATCCCTAGGGACGG - Intronic
1131909677 15:97184003-97184025 ATTTCAGGCCTCCCTGGAGTAGG + Intergenic
1132375618 15:101326588-101326610 CTCCCAGGCCCCGCTGGGGCTGG + Intronic
1132504153 16:298353-298375 GCCCCCGGCCACCCTGGGCTGGG - Intronic
1132504636 16:301409-301431 GAGCCAGGACTCCATGGGGTGGG + Intronic
1132822839 16:1885148-1885170 GTCCCTGGCTTTCCTGGGTTTGG + Intergenic
1132823205 16:1887864-1887886 GTCCCAGGCCTTGCTGGGGGAGG - Intergenic
1133326590 16:4945762-4945784 GCCCTAGGCCTCTCAGGGGTGGG + Intronic
1133469496 16:6060840-6060862 TTTCCAGGGCTGCCTGGGGTTGG + Intronic
1134464190 16:14458760-14458782 TGCCCTGGCTTCCCTGGGGTAGG - Intronic
1134687209 16:16167206-16167228 GTCCCAGGTCTCCCTGTCATTGG - Intronic
1135207966 16:20499080-20499102 CTCCCAGGGCTCCCAGGGGCAGG - Intergenic
1135210933 16:20524620-20524642 CTCCCAGGGCTCCCAGGGGCAGG + Intergenic
1135721364 16:24821305-24821327 GCACCAAGCCTCCCTGGGGTGGG - Intronic
1135937456 16:26793275-26793297 AGCCCAGGCCTCCAAGGGGTAGG + Intergenic
1136079711 16:27843864-27843886 GTCCCAAGCTTCCCTCTGGTGGG - Intronic
1136395509 16:29990704-29990726 GGCCCAGGCCTACCTGGGGCAGG + Intronic
1136588215 16:31201602-31201624 GTCCCAGTCCTACCTGGTGGAGG - Exonic
1136702363 16:32156078-32156100 GCTCCAGGCTTCCCTGGTGTGGG - Intergenic
1136765304 16:32771410-32771432 GCTCCAGGCTTCCCTGGTGTGGG + Intergenic
1136802795 16:33098974-33098996 GCTCCAGGCTTCCCTGGTGTGGG - Intergenic
1137291034 16:47052074-47052096 GTCCCTGTCCTCACTGGGGAGGG - Intergenic
1138679826 16:58676508-58676530 GTCCCAGGGCCCTCTGGGATGGG + Intronic
1138681107 16:58684322-58684344 CTCCCAGTCCAGCCTGGGGTTGG + Exonic
1139956449 16:70695486-70695508 GTCCAAGGCTGCCCTGGAGTGGG - Intronic
1141593466 16:85083554-85083576 CTCCCAGCCCTCCTTGGGCTAGG - Intronic
1142007302 16:87695598-87695620 GTCCCAGCCATTCCTGGGCTGGG + Intronic
1142129869 16:88427658-88427680 GTCCCTGGCCTGCCTTGGCTGGG - Exonic
1142133241 16:88440395-88440417 GTCCCAGGCCTGGGTTGGGTCGG - Exonic
1142222677 16:88863433-88863455 GTGCCAGGCCAGCTTGGGGTTGG - Exonic
1142323471 16:89400044-89400066 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323483 16:89400082-89400104 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323494 16:89400120-89400142 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323505 16:89400158-89400180 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323516 16:89400196-89400218 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323527 16:89400234-89400256 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323538 16:89400272-89400294 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323549 16:89400310-89400332 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323560 16:89400348-89400370 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323571 16:89400386-89400408 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323582 16:89400424-89400446 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323593 16:89400462-89400484 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323605 16:89400500-89400522 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323616 16:89400538-89400560 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323628 16:89400576-89400598 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323640 16:89400614-89400636 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323651 16:89400652-89400674 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323663 16:89400690-89400712 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323675 16:89400728-89400750 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1142323686 16:89400766-89400788 GCCCCAGGCTTCCCTGCGCTGGG + Intronic
1203067692 16_KI270728v1_random:1033643-1033665 GCTCCAGGCTTCCCTGGTGTGGG + Intergenic
1143055820 17:4161006-4161028 GTCTCTGCCCTCCCTGGGGCAGG + Intronic
1143711991 17:8741724-8741746 GGCCCAGGCCTTCCTGGGGCTGG + Intronic
1143765617 17:9135705-9135727 GTTCTAGGGCTCCCTGGAGTAGG + Intronic
1144669793 17:17126532-17126554 GTCCCTGTCCTCCCTGGGATGGG + Intronic
1145060126 17:19727983-19728005 ATCCCAGGCCTCCCAGAGGCAGG + Intergenic
1146008598 17:29177764-29177786 GTCCCAGGCCTGAGTGTGGTGGG - Intronic
1146054315 17:29573638-29573660 TTCCCAGGCCTCCAGAGGGTGGG + Exonic
1146655079 17:34630261-34630283 AACCCAGGCCTCCCTGTGCTGGG + Intronic
1146833382 17:36089586-36089608 GTCCAAGGCTTCTCTTGGGTTGG - Intronic
1147141867 17:38464854-38464876 GGCCCAGGCATTCCTGTGGTTGG + Intronic
1147667843 17:42160006-42160028 GGCCCAGGCCTGTCTGGGGTGGG - Exonic
1147872049 17:43594321-43594343 GTCCCAGCCCTCCCAGTGGGAGG - Intergenic
1147967356 17:44200227-44200249 GGCCGAGGCCTCCCTGCGATTGG - Intergenic
1147968552 17:44207211-44207233 CTCCCTGGCTGCCCTGGGGTGGG + Exonic
1148864113 17:50619715-50619737 GATCCAGGGCTCCCTGGAGTGGG + Exonic
1149237722 17:54612758-54612780 GTCCTAAGCTTCACTGGGGTGGG - Intergenic
1149993734 17:61396523-61396545 GTCCCAGGTCTGGTTGGGGTGGG - Intergenic
1150249417 17:63697978-63698000 GTCCCAAGCCCCACTGGGGCAGG + Exonic
1150280794 17:63928786-63928808 GGCCAGGGCCTCCCTGGGGTGGG + Exonic
1150358403 17:64507161-64507183 GCCCGAGGCCTCCCTGGAGGTGG - Intronic
1151351135 17:73532865-73532887 GTCACAGGCTTCCCAGGGGCAGG + Intronic
1151385883 17:73755035-73755057 TTCCCAGGCGTCCCTTGGTTTGG - Intergenic
1151768840 17:76146511-76146533 GTCCCCTGGCTCCCTGGGGTAGG + Intronic
1151853840 17:76708243-76708265 CGCCCAGGCCTCCCTGGGAAGGG + Intronic
1151863138 17:76781135-76781157 GTTCCAGGCTTCACTGGGGGAGG + Intronic
1152070791 17:78132687-78132709 TGCCCAGGCCTCCCCAGGGTTGG + Intronic
1152195507 17:78916054-78916076 CTCCCAGGCCTCCCTCAGGGCGG + Intronic
1152350991 17:79784090-79784112 GCCACAGGCCTCCTTGGCGTGGG - Exonic
1152603833 17:81278918-81278940 ATCCCGGGGGTCCCTGGGGTAGG - Intronic
1152723926 17:81936021-81936043 GCCCCTGCCCTCACTGGGGTGGG + Intronic
1152740565 17:82016664-82016686 GTCCCAGTCCTCTCTCGGGGAGG - Intronic
1152797545 17:82315587-82315609 GACCCAGCCCTGCCTGGGGAAGG - Intronic
1152943690 17:83186437-83186459 GCCCCAGTCCTCCCTGTTGTGGG - Intergenic
1153679371 18:7485658-7485680 GTCCCAGGCCTCCGTGCAGCTGG + Intergenic
1155171498 18:23270132-23270154 GGCCCAGGGCTCCCTGCTGTGGG + Intronic
1155466391 18:26140266-26140288 GTACCAGGGCTCACTGGGGTGGG + Intronic
1156494103 18:37514605-37514627 CGCCCAGGCCTCCTTGGGCTTGG - Intronic
1156594577 18:38533145-38533167 GTTCCAGGGATCACTGGGGTGGG - Intergenic
1157292436 18:46419647-46419669 GGACCAGGCCTACCTGGGGAAGG + Intronic
1157607084 18:48932713-48932735 GGCCCTGGCCTGTCTGGGGTTGG - Intronic
1158545359 18:58391761-58391783 GGCTCAGGCCTCCCTGCTGTGGG + Intronic
1158602579 18:58867486-58867508 GGCCCAGGCCTCCCTGGAGTGGG + Intronic
1160817451 19:1042739-1042761 TCCCCAGGAATCCCTGGGGTTGG + Exonic
1161278778 19:3433969-3433991 CGCCCAGGACTCGCTGGGGTGGG - Intronic
1161453876 19:4360842-4360864 GACACAGGCCTCCCTGGGTTGGG + Exonic
1161542636 19:4861246-4861268 CTGCCAGGGCACCCTGGGGTGGG + Intronic
1161584226 19:5096466-5096488 GTCCCAGGTCTCCACGGGCTTGG + Intronic
1161911661 19:7198563-7198585 ACCCCAGGCCTCCCTCGGGAGGG + Intronic
1162127441 19:8506993-8507015 GTCCCAGGCAGCCATGGGCTCGG + Intergenic
1162146142 19:8613033-8613055 GCCCCAGACTTCACTGGGGTGGG + Intergenic
1162442457 19:10701475-10701497 TACCCAGGCTTCCCTGGAGTCGG + Exonic
1162524958 19:11201690-11201712 CTCCCAGGTCTCCCTGGGTCTGG + Intronic
1162975621 19:14205987-14206009 GTCCAGCGCCTCTCTGGGGTCGG + Exonic
1163560096 19:18013987-18014009 GTCCCAGCCCTGGCTGGGGCAGG + Exonic
1163862290 19:19748668-19748690 GTCCCAGTCCACCCTGTGGGAGG + Intergenic
1164375424 19:27679724-27679746 GTCATTAGCCTCCCTGGGGTCGG + Intergenic
1165003952 19:32789044-32789066 GCCCCTGGCCTTCCTCGGGTTGG + Intronic
1165162632 19:33826743-33826765 GTCGCAGGGGTGCCTGGGGTAGG + Intergenic
1166345662 19:42163628-42163650 GTCCCTGGCCTCCCTCAGGGAGG - Intronic
1166377422 19:42335348-42335370 GTCCCAAGACTCCCAGGTGTTGG - Exonic
1167454465 19:49591285-49591307 GTCCCGGGCGGCCCCGGGGTGGG - Intergenic
1167522019 19:49960820-49960842 GTCCCAGCCATCCCGGGGGTAGG + Exonic
1167523363 19:49969905-49969927 GTCCCAGCCATCCCGGGGGTAGG - Intergenic
1167679342 19:50909676-50909698 GACCCAGGGCTCCTGGGGGTGGG + Intronic
1167688027 19:50968735-50968757 CTCCCAGGCCTCCCTGGAAGAGG + Exonic
1168266065 19:55224738-55224760 GTCCCTGGGCTCTGTGGGGTCGG - Intergenic
1168513194 19:56989826-56989848 TTCTCAGGACTCTCTGGGGTAGG + Intergenic
925579454 2:5395873-5395895 TTCCCAGGCCTCTCTAGGCTAGG + Intergenic
927126082 2:20012991-20013013 GGCGCAGGCCCCGCTGGGGTGGG - Intergenic
928947164 2:36781939-36781961 ACCCCAGGCCTCCCTAGGGAGGG - Intronic
930634003 2:53785548-53785570 GTGCCTGGCCCCCCTGGGCTTGG - Intronic
930693881 2:54391448-54391470 GCCCCAGGCCTCAGAGGGGTGGG + Intergenic
934119966 2:88829060-88829082 GCGCCCGGCCTCCCTGGGATGGG + Intergenic
934675523 2:96247068-96247090 GTTCCAGGCCCTCCTGGGCTAGG + Intergenic
936163437 2:110101590-110101612 GCGCCCGGCCTCCCTGGGATGGG + Intronic
937136721 2:119559822-119559844 GTCTCAGGCCTGTGTGGGGTGGG + Intronic
937293577 2:120796567-120796589 CTGCCAGGCCTCTCTGGGGTAGG - Intronic
937428441 2:121818410-121818432 CTCCCAGGCATCCCTGTGGATGG - Intergenic
937954571 2:127414883-127414905 CTCCCTGCCCTGCCTGGGGTGGG + Intergenic
938265224 2:129923422-129923444 GTCCCAGCGCCCCCTGGGGACGG - Intergenic
938287010 2:130127537-130127559 GGCCCAGTCCGACCTGGGGTGGG - Intronic
938312628 2:130302818-130302840 GACCCAGCCCGACCTGGGGTGGG + Intergenic
938428583 2:131211333-131211355 GGCCCAGTCCGACCTGGGGTGGG + Intronic
938469486 2:131545351-131545373 GGCCCAGCCCAACCTGGGGTGGG + Intergenic
941115043 2:161462427-161462449 GTTCCAGGCACCACTGGGGTAGG + Intronic
946149357 2:217753745-217753767 TTCCCAGCCTTCCCTGGGGAAGG - Intronic
946203856 2:218089428-218089450 GTCCCTCCCTTCCCTGGGGTGGG - Intronic
946227068 2:218269793-218269815 TTCTCAGGCCTGGCTGGGGTGGG - Intronic
947593951 2:231399471-231399493 GCCCCAGGCCTGCCTGGAGACGG + Exonic
947712754 2:232325504-232325526 GTTCTGGGCCTCCCTGGGGCAGG - Intronic
947787804 2:232839899-232839921 GTCCCAGGCCACGCTGTCGTTGG + Exonic
947844187 2:233231017-233231039 GTCGCTGGCCTCCCTGGAGCTGG + Intronic
948197646 2:236107248-236107270 GACCCAGGCCTCTCTGGGCAAGG - Intronic
948462011 2:238134339-238134361 GTCCCAGGAGAGCCTGGGGTGGG + Intergenic
948796611 2:240406129-240406151 GTCCCTTGCCTGCCTGGTGTGGG - Intergenic
948897515 2:240934217-240934239 CTCCTGGGCCTCCCTGGGCTTGG + Intronic
1169600832 20:7258987-7259009 GTTCCTGGCCTCCCTGGGATGGG - Intergenic
1169965291 20:11210798-11210820 GTCCCAGGCATCCATGTGGTCGG + Intergenic
1170542947 20:17407205-17407227 GTCCCAGGCCTCTCTGAGGTTGG + Intronic
1171034602 20:21705417-21705439 GTCCCAGGCCCAGCTGGGGTTGG + Intergenic
1171192344 20:23167534-23167556 TTCCCAGGCCTTCCTTGGATGGG + Intergenic
1171460383 20:25294632-25294654 GGCCCAAAACTCCCTGGGGTGGG + Intronic
1173025309 20:39301938-39301960 AGGCCAGGGCTCCCTGGGGTTGG - Intergenic
1173710707 20:45153278-45153300 GGCCCAGTCCTCCCAGGGTTTGG + Intergenic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1175183132 20:57162395-57162417 GGCCCAGCCCACACTGGGGTTGG - Intergenic
1175199754 20:57268755-57268777 TTCCCCAGTCTCCCTGGGGTAGG - Intergenic
1175400285 20:58696308-58696330 GGGCCAGGCCTCCCTGGGGAGGG - Intronic
1175594492 20:60220035-60220057 GTCCCTGACCTCCCTGGTGCAGG - Intergenic
1175998316 20:62821171-62821193 GTCCCAGACTTCCCTGTGGGAGG - Exonic
1176081412 20:63275127-63275149 GTCCCTGGGCTCCCTGTCGTTGG + Intronic
1176131082 20:63497125-63497147 GTCCAGGGCAGCCCTGGGGTGGG - Intronic
1176173372 20:63706494-63706516 GTCCCAGCTCTCCCAGGGGATGG + Intronic
1176236453 20:64055953-64055975 GCCCCAGGCAGCCGTGGGGTCGG - Intronic
1178380124 21:32100679-32100701 GCAGCAGGCCTCCCTGCGGTGGG - Intergenic
1178409116 21:32349315-32349337 GTCCGTGGCCTCGCTGGAGTTGG - Exonic
1179582312 21:42351673-42351695 GCCCATGGCCTTCCTGGGGTAGG + Intergenic
1179596135 21:42444298-42444320 TTCCTAGGCCTCCCTGAGGCTGG + Intronic
1179889145 21:44327014-44327036 CTGCCAGGCCTCCCTCGGGCTGG + Exonic
1179909576 21:44440910-44440932 GTGCCTGGCCTCCCTGGAGGCGG + Intronic
1180087578 21:45514869-45514891 GTGCCAGGCTTGCCTGGGCTGGG - Exonic
1180992041 22:19942470-19942492 GGCCCAGGACTCCCCAGGGTCGG + Intronic
1181030637 22:20147545-20147567 AGCCCAGGCCTCCGTGGGTTGGG + Exonic
1181441972 22:22941434-22941456 GTCTGAGGCCTCCCTGAGGAGGG - Intergenic
1181512674 22:23395837-23395859 AGCCCAGGCCTCCGTGGAGTGGG - Intergenic
1182281069 22:29217946-29217968 GACCCAGGGCAGCCTGGGGTGGG + Intronic
1182686499 22:32124271-32124293 GTCCCAGCCTGGCCTGGGGTGGG + Intergenic
1183357326 22:37366743-37366765 GTCCCAGGCCTCCTTCGTGAGGG - Intergenic
1184214823 22:43059664-43059686 GGCCCAGATCTCCCTGGGGCAGG - Intronic
1184670884 22:46011861-46011883 GCCCCATCCCTCCCTGGGGGAGG - Intergenic
1184787381 22:46678409-46678431 AGCCCAGGCTTCCCTGGGGCAGG - Exonic
1184842231 22:47058730-47058752 GGCCCAGGCCTTGGTGGGGTTGG + Intronic
1185231936 22:49688480-49688502 GTCCCAGGCCTGGCTGGTGTGGG - Intergenic
1185370129 22:50457056-50457078 GGCCGAGGCCGCCATGGGGTTGG + Exonic
1185374095 22:50474424-50474446 CTGCCCGGCCTCCTTGGGGTGGG - Intronic
950139759 3:10607436-10607458 GTCCCTGGACTCCCTGGAGAGGG + Intronic
950496277 3:13336242-13336264 GTCCAAGGCCCACCTGGGCTTGG + Intronic
950535216 3:13574583-13574605 GCCCCAGGCCTGGCTGGGCTGGG - Intronic
952430052 3:33214429-33214451 GTCCTAGGCTTCCCTGAGTTAGG + Intronic
952945771 3:38477190-38477212 GTGCCAGGCCACCCTGAGGGAGG - Intronic
953032099 3:39185887-39185909 GACCTGGGCCTCCCTGGAGTGGG + Exonic
953785366 3:45907170-45907192 GTCCCTGGTCTCCCTGGGCTGGG + Intronic
954163695 3:48739660-48739682 GTCCCTTGCCTACCTGGGCTGGG - Intronic
954641325 3:52100042-52100064 CTCTCATGCCACCCTGGGGTGGG + Intronic
954826157 3:53375252-53375274 GTCCAAGGTCTCCCGGGAGTTGG - Intergenic
954871251 3:53769162-53769184 GCCCCTGCCCTCCCTGGGGTGGG + Intronic
961667022 3:128498883-128498905 ATCCCAGGCCCCTCTGGGATAGG - Intergenic
961743389 3:129047368-129047390 GTGCCAGGCTTCCCTGCGGGCGG - Intergenic
963296092 3:143548278-143548300 CTCCCAGGCCTGTCTGGGGGTGG + Intronic
963385306 3:144585382-144585404 GTCCAAGATCTCCCTAGGGTAGG + Intergenic
963607154 3:147421266-147421288 CCCCTAGGCGTCCCTGGGGTCGG + Intronic
965922939 3:173941468-173941490 CTCCCAGGCCTTCCAGTGGTTGG + Intronic
966207551 3:177420441-177420463 TTCCCAGGGCTCCCCAGGGTGGG + Intergenic
966722294 3:183076018-183076040 GTCCTAGTCCTCCCTGGTTTGGG + Intronic
968079607 3:195836913-195836935 TTCCCAGGCCTCTCTGAGGTGGG + Intergenic
968403485 4:318329-318351 GTCCCAGAGCTTTCTGGGGTGGG + Intergenic
968450690 4:674723-674745 TGCCCAGGCCACCCTCGGGTGGG - Intronic
968480045 4:829221-829243 GTCCCTGGCCTCACTGGGGCTGG - Intergenic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
968552122 4:1229157-1229179 GCCCCTGCCCTCCCTGGGCTGGG - Intronic
968900117 4:3426992-3427014 GGCCCAGGTCTCCCTGGGTGGGG - Intronic
969630164 4:8331232-8331254 CTCCCAGGGCTCACTGTGGTGGG + Intergenic
969691254 4:8705393-8705415 TCCCCAGGCCACCCTGGGGTGGG - Intergenic
969716554 4:8870948-8870970 GTCCCCAGCCTCCCTGGGACCGG + Intronic
969723836 4:8907704-8907726 GCCCCTGGCCTCCCTTGGCTTGG - Intergenic
970098820 4:12496914-12496936 GTCCCAGTCCTTCCCGGAGTGGG + Intergenic
970656967 4:18241932-18241954 CTCCCCAGCCTCACTGGGGTTGG + Intergenic
973704003 4:53564000-53564022 GGCCCACGCCTCCCTGATGTGGG + Intronic
977415617 4:96729441-96729463 GCCCGAGTCCTCCATGGGGTAGG - Intergenic
977582000 4:98735829-98735851 GCACCAGGCTTCCCTGAGGTGGG - Intergenic
979043649 4:115834371-115834393 GTTCCAGGCACCACTGGGGTAGG - Intergenic
980029345 4:127808673-127808695 GTCCCAGGTCTCTCTGAGGATGG - Intronic
980421448 4:132566056-132566078 GTCACAGGCCTGCAGGGGGTAGG + Intergenic
985565107 5:611813-611835 GCCCCGGGCCTCCCAGAGGTGGG - Intergenic
985575088 5:670204-670226 GTCACAGGCCCCGCTGGGCTCGG + Intronic
986209604 5:5658507-5658529 GTGCCAGGCTTCCCTGGGTTCGG - Intergenic
989665201 5:43846177-43846199 GTCCCAGGCATCTGGGGGGTGGG + Intergenic
992383265 5:76259338-76259360 TTCCCAGGCCTGCCTAAGGTTGG - Intronic
992970002 5:82046593-82046615 GACAAAGGCCTCCCTGGGATGGG - Intronic
997725974 5:136120123-136120145 GTCCCAGGCTAGCCTGGGGTCGG + Intergenic
997856674 5:137378960-137378982 TTCCCAGGGCTCCACGGGGTTGG + Intronic
997979360 5:138459347-138459369 CTCAAAGCCCTCCCTGGGGTAGG + Intergenic
998164775 5:139836764-139836786 GGCCGAGGCCTCCCTGGAGGTGG + Intronic
998549719 5:143065759-143065781 GTGTCATGCCTCCCTAGGGTGGG - Intronic
999070605 5:148739772-148739794 ATCCCAGGGCTCCCTGGGATGGG + Intergenic
1002437029 5:179238001-179238023 GTTCAAGGCCTCCGTGGGGCGGG - Intronic
1002618269 5:180468822-180468844 GCGCAAGGCCTCCCTGAGGTGGG + Intergenic
1002709270 5:181184429-181184451 GCCACAGGCCGCGCTGGGGTAGG - Intergenic
1002855666 6:1035814-1035836 GTGCCAGGCCTCCCGGCTGTAGG + Intergenic
1003404126 6:5814794-5814816 TGCCCAGGTCTCCATGGGGTGGG - Intergenic
1004389927 6:15201611-15201633 GCTCCAGGGCTCCCTTGGGTTGG - Intergenic
1005652387 6:27896109-27896131 GTCCCAGCCCTCAGTGTGGTTGG - Intergenic
1005778393 6:29162056-29162078 GTTCCAGGCATCACTAGGGTAGG + Intergenic
1007719831 6:43878393-43878415 GTCCCCGTCCTGCCTGGGGAGGG - Intergenic
1007748739 6:44059008-44059030 CTCCCCCGCCTCCCTGGGGAGGG + Intergenic
1007753140 6:44081980-44082002 TCCCCAGGCCTCCCTGTGATTGG - Intergenic
1007779643 6:44245702-44245724 TTCCCAAGCATCCCAGGGGTGGG + Intergenic
1008228986 6:48960064-48960086 GTCCCAGGCATCTATGGGGGAGG - Intergenic
1009775869 6:68205724-68205746 GTTCCAGGCACCACTGGGGTAGG - Intergenic
1010771683 6:79839422-79839444 TTCCCTGGCTCCCCTGGGGTTGG + Intergenic
1014434963 6:121410624-121410646 GTGCCAAGCCTCCCATGGGTTGG - Intergenic
1014970822 6:127813132-127813154 TTCCCAGCACTCCGTGGGGTTGG + Exonic
1019062610 6:169266868-169266890 GTCCCAGGGCCCCCAGGGGTGGG + Intergenic
1019183367 6:170207010-170207032 CTACCCAGCCTCCCTGGGGTTGG + Intergenic
1019355955 7:579106-579128 GTCCGGGGCCTCCATGGGGTGGG - Intronic
1019661656 7:2227583-2227605 GTCCCAGGCTTTCCTGGCCTTGG - Intronic
1019707861 7:2504996-2505018 GGACCAGGCCTCCCAGGGGGTGG + Intergenic
1020124669 7:5526800-5526822 GTGCCATGCCTCACTGGGGCTGG - Intergenic
1022330058 7:29370185-29370207 TTCCCAAGCCTCCCAGGAGTTGG + Intronic
1022598445 7:31734455-31734477 GTCCCAGGGCTCCTTGGTGCAGG - Intergenic
1023038758 7:36154353-36154375 GTCCGAGGGGTCCCTGGGGATGG - Exonic
1023705069 7:42932499-42932521 TTCCCAGTCCTCCGTGGGGTAGG + Exonic
1023979006 7:45055163-45055185 CTCCCTGGCCTCCCTGTGGCTGG - Intronic
1026564765 7:71480867-71480889 GCACAAGGCCTCCATGGGGTTGG - Intronic
1026904702 7:74056369-74056391 GTCGCAGGTGTCCCTGGTGTCGG + Exonic
1026909848 7:74085156-74085178 GTGCCAGGCCTCCCTGGGACAGG + Intronic
1032136493 7:129284069-129284091 TTTCCAGGACTTCCTGGGGTAGG + Intronic
1032977451 7:137241909-137241931 GTCCCAGGCCAGCCTGTGGTGGG + Intronic
1034265077 7:149776858-149776880 TCCCCAGGCCTCCCCAGGGTGGG + Intergenic
1034369466 7:150582371-150582393 TTCCCAGCCCTCCAAGGGGTGGG - Intergenic
1034558741 7:151866241-151866263 AGCCAAGGCCTCCCTGGGGTAGG - Intronic
1035185868 7:157125516-157125538 GACACAGGCCTCCCTGGGGCCGG - Intergenic
1035367437 7:158358186-158358208 GTCTCAGGTCTCCCTGTGGTTGG - Intronic
1038683611 8:29694476-29694498 GGCTCAGGCCTCCCTGGGTTGGG + Intergenic
1041734524 8:61095546-61095568 GTCGCTGGCCTACCTGGGGTTGG - Intronic
1045562533 8:103279674-103279696 GTGCCAGGCCACCCTGGCTTTGG - Intergenic
1047213390 8:122857860-122857882 GTTCCAGGAGGCCCTGGGGTGGG - Intronic
1047285962 8:123487375-123487397 CTGCCAGGTCTCCCTGGGGCAGG + Intergenic
1048443491 8:134476942-134476964 GTCACAGCGCCCCCTGGGGTGGG - Intergenic
1048465920 8:134664553-134664575 CTCCCAGGCCTCCCACGGGGAGG + Intronic
1048861197 8:138725397-138725419 GTCCCAGGCCCCCCTGGACCGGG - Exonic
1048970667 8:139643441-139643463 GTCCCAGGACTCACTGGGGAAGG + Intronic
1049379746 8:142306017-142306039 GCCCCTGCCCTCCCTCGGGTCGG - Intronic
1049813117 8:144585172-144585194 GTCCCAGTTCTCCCTGCTGTGGG - Intronic
1049849515 8:144823304-144823326 GCCCCAGCCCTCCGTGAGGTGGG + Intergenic
1049969344 9:807788-807810 GCAACAGGCCTCCCTGGGGATGG - Intergenic
1055565503 9:77564574-77564596 GTCCCAGTCCTCCCTTTGGGAGG + Intronic
1059418238 9:114175213-114175235 GGCTCAGGCCTGCCTGGGGGAGG - Intronic
1059437170 9:114283896-114283918 GGCCCAGCGCTCCCTGGGGCAGG - Intronic
1060801105 9:126546312-126546334 AGCACAGGCGTCCCTGGGGTGGG + Intergenic
1060801552 9:126548662-126548684 AGCACAGGCATCCCTGGGGTAGG - Intergenic
1061033239 9:128099423-128099445 GCCACATGCCTCCCTGGGGTGGG - Intronic
1061484779 9:130914728-130914750 GTTCCAGGCGTCCCAGTGGTGGG - Intronic
1061574513 9:131497662-131497684 TTCCCAGGCAGCTCTGGGGTGGG - Exonic
1061937475 9:133866142-133866164 GTTCCAGGCCCCCCAGGGGGTGG + Intronic
1062309596 9:135928813-135928835 GTGCTTGGCCTCTCTGGGGTGGG - Intergenic
1062357971 9:136173966-136173988 GCCCCAGGCCTCCCTGATGTGGG - Intergenic
1185620696 X:1451168-1451190 GTCCCAGGACCCCCTAGGGATGG - Intronic
1187168734 X:16829942-16829964 GTCCCAGGAGTCACTGGGTTTGG + Intronic
1189302172 X:39960013-39960035 GTCCCAGGCTTCCCGGGGATCGG - Intergenic
1189996316 X:46642172-46642194 CTCCCAGTCATCCTTGGGGTTGG - Intronic
1191802678 X:65098845-65098867 GTTCCAGGCACCACTGGGGTAGG - Intergenic
1194974568 X:100380436-100380458 GTCCCCTGCCTTCATGGGGTGGG - Intronic
1197146525 X:123178408-123178430 CTCCCAGCCCTACCTGGGGAGGG - Intergenic
1197293090 X:124684482-124684504 GCACCAGGGTTCCCTGGGGTGGG - Intronic
1197870340 X:131058073-131058095 GACTCTGGGCTCCCTGGGGTAGG + Intergenic
1198079265 X:133223691-133223713 GTCCCAGGAGTCTCTGGGATTGG + Intergenic
1198552406 X:137758698-137758720 GTCCCAGGCTTTGCTGGGCTTGG + Intergenic
1200064417 X:153497689-153497711 TTCCCAGGGTTCCCTGGGGAAGG + Intronic
1200097828 X:153672459-153672481 GCCCCAGGCCTCCCAAAGGTTGG + Intronic
1200126079 X:153815732-153815754 TTCCCAGGGTTCCCTGGGGAAGG - Intronic
1200134404 X:153867898-153867920 GGCCCAGGGCTCCCTGAGGGTGG + Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic
1200281329 X:154779395-154779417 GTCACTGGCCTCTCTGGGCTGGG - Intronic