ID: 1076802537

View in Genome Browser
Species Human (GRCh38)
Location 10:132837262-132837284
Sequence TGGAGGACACAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 686}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076802537_1076802544 13 Left 1076802537 10:132837262-132837284 CCTCCATCCTTCTGTGTCCTCCA 0: 1
1: 0
2: 5
3: 47
4: 686
Right 1076802544 10:132837298-132837320 GACATACATGTACAGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076802537 Original CRISPR TGGAGGACACAGAAGGATGG AGG (reversed) Intronic
900005658 1:47918-47940 TGGAGGAGATAGAAGGTTGAAGG - Intergenic
900325658 1:2107609-2107631 TGGAGGAAACACAGGGAGGGAGG + Intronic
900693298 1:3994799-3994821 AGGAGGCCACACAAGGGTGGAGG + Intergenic
900697059 1:4019081-4019103 TCCAGGACACAGCAGGATGGCGG - Intergenic
900701846 1:4053434-4053456 TGGTGAACACAGCAGGATGGGGG - Intergenic
900943081 1:5813751-5813773 AGGAGAACAGAGAAGGAAGGAGG + Intergenic
901260100 1:7864993-7865015 GGGAGGACACAGGGGGATGATGG - Intergenic
901260112 1:7865050-7865072 GGGAGGACACAGGGGGATGATGG - Intergenic
901260135 1:7865162-7865184 GGGAGGACACAGGGGGATGATGG - Intergenic
901463454 1:9405466-9405488 GGGAGGACACAGAGCAATGGAGG - Intergenic
901464104 1:9409821-9409843 TGGAGGACACAGAACAGTGGAGG - Intergenic
902066594 1:13693347-13693369 TGGGCGACACAGCAGGATGTGGG - Intergenic
902117742 1:14136033-14136055 TGGAGGTCTCTGAAGAATGGGGG + Intergenic
902297439 1:15477673-15477695 TTGAGGAAACAGAAAGATTGGGG - Intronic
902662669 1:17916015-17916037 TCCAGGGCACAGAAGAATGGGGG + Intergenic
902826579 1:18978792-18978814 TGGAGGGCAGGGAGGGATGGGGG - Intergenic
903379627 1:22887592-22887614 TGGAGGCCACTGATGAATGGCGG + Intronic
903809600 1:26028116-26028138 TGGTGGACACTTAAGCATGGAGG + Intronic
904406995 1:30297921-30297943 TGGAGAATTCAGAAGGTTGGAGG - Intergenic
905022185 1:34825583-34825605 TGGAGGAAACAGGCGGCTGGCGG + Intronic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905585994 1:39118863-39118885 AGGAGGAGACAAAAGGATGCTGG - Intronic
905626844 1:39495068-39495090 TGGAGGCCCCTGAAGGTTGGTGG + Intronic
905701381 1:40018379-40018401 TGGAGGACACTGAGCGATGCTGG - Intergenic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905770615 1:40635867-40635889 TGGAGGACCGAGGAGGAGGGAGG + Intronic
905864564 1:41369678-41369700 TGGAGGACCCAGAAGGAGTGAGG - Intronic
906351757 1:45066733-45066755 AGGAGGCCACTGAAGGATGGTGG + Intronic
906508756 1:46398850-46398872 AGGAGGACACAGCTGGATGAAGG + Intronic
906713576 1:47951043-47951065 TGGAGGTCACAGGGGCATGGTGG + Intronic
906933166 1:50189200-50189222 TGGAGGACAGACAAGGAGTGAGG + Intronic
907608889 1:55847855-55847877 TGGAGGACACGGAAGGCAGGAGG - Intergenic
907927337 1:58966858-58966880 TGGGGCACACAAAAGGAAGGAGG - Intergenic
908050907 1:60229452-60229474 TGGAAAACATAGAAGGGTGGAGG + Intergenic
908075977 1:60518450-60518472 TGGAGGCCTCAGAATCATGGTGG + Intergenic
908101498 1:60796073-60796095 TGGAGGTCTCAGAATCATGGTGG + Intergenic
909146603 1:71941560-71941582 TGGAAGACAGTGAAGGGTGGTGG + Intronic
909700607 1:78517676-78517698 TTGAGGACACAGAAGAAGGTAGG + Intronic
910897559 1:92084521-92084543 TGGAGGACATTAAAGGAAGGGGG + Intronic
910914910 1:92278321-92278343 TGGAGCACACAAAAGTCTGGGGG - Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911520754 1:98927354-98927376 TGGAGGCCAGTGAAGGCTGGTGG - Intronic
912233370 1:107821624-107821646 TGGAAGACAGAGGAGGTTGGAGG + Intronic
912383910 1:109261904-109261926 TGGAGGGCACAGAGGGTTGGGGG + Intronic
913201828 1:116501068-116501090 TGGAGGAACTAGAAGGCTGGGGG - Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
913523190 1:119665772-119665794 TGGAGAACCCTGAAGGATGCAGG + Intronic
915325177 1:155078391-155078413 AGGTGGGCACAGAAGGGTGGTGG - Intergenic
915540388 1:156562272-156562294 TGGAGAATACATGAGGATGGGGG - Intronic
915964506 1:160294562-160294584 TGGAGGCTACAGAAGGTTTGGGG - Exonic
916814564 1:168338732-168338754 GGGAGGCCTCAGAAGCATGGTGG + Intergenic
917141157 1:171837569-171837591 GTGAGGACACAGCAGGAAGGTGG - Intergenic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
918043193 1:180925734-180925756 TCGAGGACACAGGTGGCTGGAGG + Intronic
918130393 1:181622513-181622535 GGGAGGACACAGCAAGAAGGGGG - Intronic
919147601 1:193655278-193655300 TGGGGGGCACAGAAGGGTGTGGG + Intergenic
919375983 1:196795557-196795579 TGGAGGACTCAGAAGAAGGCAGG + Intergenic
919385689 1:196920445-196920467 TGGAGGACTCAGAAGAAGGCAGG + Intronic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
920052795 1:203173678-203173700 TGGAGGAGCAAGAAGGAAGGTGG + Intronic
921044684 1:211466831-211466853 GGGAGGACTCAGAATCATGGCGG - Intergenic
921305585 1:213793232-213793254 TGGAGGAGAGAGAAGGAGGCTGG - Intergenic
921379293 1:214507308-214507330 TGGAGGGCTGAAAAGGATGGGGG - Intronic
921684457 1:218074228-218074250 TGGAGGACAGGAAAGGATGGAGG - Intergenic
922061943 1:222101282-222101304 TGCACTACACAGGAGGATGGGGG - Intergenic
922533942 1:226365913-226365935 GGCAGGACACAGAAGGAAGTGGG + Intronic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922728167 1:227935533-227935555 TGGAGGATACAGAATGTTAGAGG - Intronic
922798390 1:228352842-228352864 TGGGAGACACACCAGGATGGGGG + Intronic
923047785 1:230368164-230368186 TGGAGGAGAGAGAAGGCTTGGGG + Intronic
923120282 1:230983750-230983772 TGGAGAACACAGCAGGACAGAGG + Intronic
923786647 1:237074445-237074467 GGGAGGACACTGATGGATAGAGG + Intronic
924309370 1:242724188-242724210 TGGGGGACAGAGAAGGAAGAAGG - Intergenic
1062798049 10:358816-358838 TGGAGGGGGCAGAGGGATGGGGG + Intronic
1062875969 10:943315-943337 TGGAGGTGACAGGAGGAGGGAGG - Intergenic
1062971937 10:1654782-1654804 TGCAGCACACAGAAGCATGCAGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063018035 10:2097694-2097716 TGGATGACAGAGATGGATGGCGG + Intergenic
1065531582 10:26675549-26675571 TGGTGGACCGAGAAGGAAGGTGG - Intergenic
1066219694 10:33323197-33323219 TTTAAAACACAGAAGGATGGGGG - Intronic
1066546172 10:36502936-36502958 TGGAGGAGACAGAGGAATCGAGG - Intergenic
1067427475 10:46220841-46220863 GGGAGGACACAGGAGGAAGGTGG + Intergenic
1067582905 10:47456751-47456773 GGGAGGACACAGGAGGAAGGCGG + Intergenic
1069696926 10:70393419-70393441 GTGAGGACACAGAAAGAAGGTGG - Intergenic
1069740394 10:70683490-70683512 TGGAGGACACAGAGGGGCTGTGG + Intronic
1069891457 10:71655097-71655119 TGGAGGGCACAAAAGGAAGCAGG + Intronic
1069902612 10:71714772-71714794 TGTGGGTCACAGCAGGATGGGGG + Exonic
1070563150 10:77583035-77583057 TGTAGCACAAAGAAGGTTGGAGG - Intronic
1070594513 10:77822866-77822888 TGGAAAACACAAAAGCATGGAGG + Intronic
1070936190 10:80297670-80297692 AGCAGGTCACAGAATGATGGAGG - Intergenic
1071068595 10:81666497-81666519 TGGAGGATAAAGGAGGGTGGTGG + Intergenic
1071321282 10:84461395-84461417 TTGAAGTCACAGAAGGATAGGGG - Intronic
1072231040 10:93414211-93414233 GGGAGGACACAGAAGGAGAAAGG - Intronic
1072251474 10:93585590-93585612 AGGAGGACAGAGAAGGAGGATGG + Intronic
1072896978 10:99375829-99375851 TGGAAGAAGCAGAAGGATTGGGG + Intronic
1073734300 10:106327850-106327872 TGGAGGGCTCAGAAGAATGCAGG - Intergenic
1073759828 10:106617284-106617306 AGGAGGAGGCAGAAGGAGGGAGG - Intronic
1073860573 10:107733387-107733409 TAGAGGACATAGGAGGAAGGAGG + Intergenic
1074168505 10:110908543-110908565 TTGAGGATCCTGAAGGATGGGGG + Intronic
1074955873 10:118388636-118388658 GTGAGGACACAGGAGGAAGGTGG + Intergenic
1075640573 10:124061427-124061449 GGGAGGACCCAGAATCATGGTGG - Intronic
1075695945 10:124435432-124435454 TGGAGGTCACAGACAGGTGGTGG - Intergenic
1076095496 10:127732284-127732306 TGGAGGCCACAGGAGGAATGTGG - Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1076840928 10:133044825-133044847 TGGAGGACAAAGAGACATGGGGG - Intergenic
1077283211 11:1754675-1754697 TGGAGGAAATGGAGGGATGGAGG + Intronic
1077693076 11:4366931-4366953 TGAAGGACATAAAAGAATGGAGG + Intergenic
1078532886 11:12150638-12150660 TGGAGGATATAGAGGGATGCTGG - Intronic
1078701260 11:13685670-13685692 TCGAGCACACACAATGATGGTGG + Intronic
1080032946 11:27681113-27681135 TTGTGGAAACACAAGGATGGGGG + Intronic
1080332037 11:31149939-31149961 TTCCGGACACAGAAGGATTGCGG + Intronic
1080446500 11:32342767-32342789 TGGAGGAGAGAGATGGCTGGAGG + Intergenic
1083000910 11:59289820-59289842 TGGAGGACGCAGTAGGTTGTGGG - Intergenic
1083908850 11:65693322-65693344 TGGAAGACAAACAAGAATGGTGG - Intergenic
1084561468 11:69907879-69907901 TGGAGGCCAGAGCAGGTTGGCGG + Intergenic
1084604709 11:70165700-70165722 AGGAGGACACAGAGGGAAGGTGG + Intronic
1084656700 11:70523863-70523885 TGAAGGACACAGCAGGATGAAGG - Intronic
1085350194 11:75793310-75793332 TGTAGGACCCAGAAGAATGTAGG - Intronic
1085931554 11:81089343-81089365 GGGAGGAAGCAGAAGGAAGGAGG - Intergenic
1086274852 11:85114445-85114467 TGAATGAGACAGAAGGAAGGTGG - Intronic
1086749455 11:90472986-90473008 TGGAGGAAACTGAATCATGGTGG + Intergenic
1087265449 11:96055641-96055663 TGCTTGACACAAAAGGATGGGGG - Intronic
1088528650 11:110784969-110784991 TGGAGGACTCAGAAGAAGGCAGG + Intergenic
1088701098 11:112412498-112412520 TGGAGTACACAGTCTGATGGGGG - Intergenic
1088712777 11:112523637-112523659 TGGAGGACACAGCACCGTGGGGG + Intergenic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089344920 11:117785024-117785046 AGGAGGACACTGAAGGGTGCAGG - Intronic
1089440447 11:118511715-118511737 TGGAGGACACAGAAGCACTAAGG - Intronic
1089835093 11:121363361-121363383 TGGAGGACTCAGAAGAGTGCAGG + Intergenic
1090339649 11:126005796-126005818 TGGAGGGCAGGCAAGGATGGTGG - Exonic
1090397968 11:126431719-126431741 TGGAGGACACAGGGGCTTGGTGG + Intronic
1090875639 11:130786458-130786480 AGGAGGTCACAGCAGGAAGGTGG - Intergenic
1090975107 11:131673336-131673358 TAGAGGACAAAGGAGGCTGGTGG + Intronic
1091116335 11:133017123-133017145 GTGAGGACACAGAAAGATGATGG - Intronic
1091941943 12:4493700-4493722 TGGAGTACACACATGCATGGAGG + Intronic
1092855193 12:12666582-12666604 TGGAGAAGACAGAAACATGGAGG - Intronic
1095873453 12:47055392-47055414 AGGAGAACAAAGAAGGGTGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096569900 12:52516300-52516322 TGGAGGACAAGGGTGGATGGAGG + Intronic
1096784960 12:54011659-54011681 GGAAGGACTCAGAAGGGTGGGGG - Exonic
1096838639 12:54367977-54367999 GGGAGGATTCAGAAGGATGCGGG - Intergenic
1098185360 12:67890681-67890703 GAGTGGACACAGGAGGATGGTGG + Intergenic
1098719403 12:73876772-73876794 TGGAGGAGACAGAGGCATGGTGG + Intergenic
1098731493 12:74040920-74040942 TGGAGGTCACATAAGTAAGGAGG + Intergenic
1098849916 12:75583784-75583806 AGGAAGACAGAGAAAGATGGAGG - Intergenic
1098924381 12:76333505-76333527 GGGAGGCCTCAGAAGCATGGCGG - Intergenic
1099525793 12:83718259-83718281 TGGAGGACCCACAATCATGGTGG - Intergenic
1099918354 12:88924677-88924699 GGGAGGACACAGCAAGAAGGTGG + Intergenic
1101158646 12:101951766-101951788 TGAAGGTCACAGAAGGAAGTTGG + Intronic
1101414471 12:104497355-104497377 GGGAGGACACGGCAAGATGGTGG + Intronic
1101935488 12:109053123-109053145 TGGGGGACCCAGAAGGACTGGGG - Intronic
1102261405 12:111445612-111445634 TGGCGGACACAACAGGCTGGGGG - Intronic
1102507806 12:113394832-113394854 TGAAGGACACAGCAGGATGTGGG - Intronic
1102635871 12:114323384-114323406 TGGAGGAGAAAGAATGCTGGAGG - Intergenic
1102913050 12:116733093-116733115 TGAAGGACACAGAAGAAGGCAGG + Intronic
1103064813 12:117888617-117888639 GTGAGGACACAGAAAGAAGGTGG + Intronic
1103244688 12:119446553-119446575 GGGAGGTTACAGAAGGATGTGGG + Intronic
1103920012 12:124394449-124394471 TGGTGGACACAAAATGTTGGGGG - Intronic
1104285926 12:127424657-127424679 GTGAGGACACAGCAAGATGGCGG + Intergenic
1104901680 12:132192767-132192789 GGGAGGACAGAGGAGGATGAGGG - Intergenic
1105307849 13:19181613-19181635 AGGAGGTCAGAGAAGGATGCGGG - Intronic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1106129357 13:26926643-26926665 TGGATGACACAGATGGAGGCTGG - Intergenic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108756353 13:53507723-53507745 ATGAGGACACAGAAGCATGGTGG - Intergenic
1109131154 13:58587401-58587423 TTGAAAACACAGAAAGATGGTGG + Intergenic
1109876188 13:68406602-68406624 TGGAGGACTCAGAAGAAGAGAGG - Intergenic
1111336704 13:86835577-86835599 TGGAGGCCTCACAAGCATGGTGG + Intergenic
1112895849 13:104298902-104298924 TGGAGGCCACAGGAAGATGGTGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1115079498 14:29433927-29433949 TGGAGAACACAGGAAGCTGGTGG + Intergenic
1116677275 14:47921926-47921948 TGAAGGACACAGATGGATATTGG - Intergenic
1117516711 14:56509026-56509048 AGCAGGACAAAGTAGGATGGAGG + Intronic
1118077320 14:62314255-62314277 TGGAGGAGACAGAAGGAAACGGG + Intergenic
1118149275 14:63172108-63172130 TGGAGGACATAGGAGGAATGGGG + Intergenic
1119033405 14:71210134-71210156 TGGTGGACAGAGAAAGGTGGAGG + Intergenic
1119620822 14:76130813-76130835 TGAAGGACCCAGAAGGTGGGTGG - Intergenic
1119725994 14:76922209-76922231 TGGAGGACAGTGGAGGATGAAGG + Intergenic
1119726010 14:76922257-76922279 TGGAGGACGGTGGAGGATGGAGG + Intergenic
1120091260 14:80335274-80335296 AGGAGGACCCAGAATCATGGCGG + Intronic
1120704459 14:87732974-87732996 TGGATGACACAGAAAGACAGTGG + Intergenic
1121428683 14:93872053-93872075 TGGAGGGCACAGGAGGTGGGGGG + Intergenic
1122651992 14:103231243-103231265 TGGACGGCCCAGGAGGATGGAGG + Intergenic
1122697200 14:103562030-103562052 TGGAGGCCACGGAGGGAAGGCGG + Exonic
1122730477 14:103793326-103793348 TGGAGGTCACTGAATCATGGAGG + Intronic
1123477415 15:20599368-20599390 TGGGGGACCCAGGAGGGTGGAGG - Intergenic
1123640601 15:22401014-22401036 TGGGGGACCCAGGAGGGTGGAGG + Intergenic
1123721117 15:23062777-23062799 TGGAGGGCACAGAAGAAGAGAGG - Intergenic
1124154085 15:27209871-27209893 GTGAGGACACAGCAGGAAGGTGG - Intronic
1124415952 15:29473367-29473389 AGGAGGCCACCGAGGGATGGTGG + Intronic
1124661790 15:31555732-31555754 CGGAGGAGTCAGATGGATGGTGG + Intronic
1125547027 15:40513351-40513373 AGGAGGACCCAGGAGGATGCAGG - Intergenic
1126114827 15:45199058-45199080 TGGAGGATGCAGCAGGAGGGAGG - Exonic
1127853509 15:62935663-62935685 TGGAGGACAGAGAGTGAGGGTGG + Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128354996 15:66919858-66919880 CGGAGGACACACATGTATGGGGG - Intergenic
1128662000 15:69508327-69508349 TAGAGGACACAGTAGGGTGATGG + Intergenic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1129157883 15:73730133-73730155 TGGAGGAGACAGCTGTATGGGGG + Intergenic
1129160253 15:73743368-73743390 TGGAGGAAAGAGAAAGAGGGAGG + Intronic
1129249677 15:74302090-74302112 TGGAGGAGACAGGTGGAGGGAGG - Intronic
1129380085 15:75159068-75159090 TGGAGGCCACAGAAAGAAGGAGG + Intergenic
1129676958 15:77636911-77636933 TGGAGGCCAGACAGGGATGGAGG + Intronic
1129819343 15:78586828-78586850 GGCAGGACACAGAAAGATGAGGG + Intronic
1130840291 15:87693652-87693674 TTGAGGTCAGAGAATGATGGGGG - Intergenic
1131602711 15:93865759-93865781 TGGAGGAGGCAGAAGGAAGTGGG + Intergenic
1131723729 15:95200721-95200743 TGGAGGGCTCAGAAGAATGTAGG + Intergenic
1132083918 15:98891236-98891258 TGAATGACCCAGAAGGATGCTGG + Intronic
1132181438 15:99755660-99755682 TGGATGACACAGAAGGTCGTTGG + Intergenic
1132447857 15:101943004-101943026 TGGAGGAGATAGAAGGTTGAAGG + Intergenic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1133849659 16:9490252-9490274 AGGAGGAGAGAGAAGGAGGGAGG + Intergenic
1134176753 16:12013088-12013110 GGGAAGAGACAGAAGGATTGAGG + Intronic
1135218777 16:20595103-20595125 TGGTGGATACTGAAGGATGGTGG + Intergenic
1135345511 16:21685470-21685492 TGGAGGAGGCAGAAGGAGAGAGG - Intronic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1135885403 16:26301589-26301611 TCCAGGAAACACAAGGATGGAGG + Intergenic
1136125807 16:28179549-28179571 TGGAGGAAACAGAAGCATCAAGG - Intronic
1138062073 16:53902330-53902352 GGAAGGACTCAGAAGGATGTAGG + Intronic
1141657790 16:85425272-85425294 TGGAGGACCCAGAAGGCAGGAGG + Intergenic
1142978111 17:3657088-3657110 AGGAGGGCACAGAAGGGAGGAGG + Intronic
1142978119 17:3657112-3657134 AGGAGGGCACAGAAGGGAGGAGG + Intronic
1143368864 17:6425955-6425977 TTGAGGAAACCGAGGGATGGGGG - Intronic
1143395231 17:6589283-6589305 TTGAGGACACAGCAAGAAGGTGG + Intronic
1143557272 17:7669692-7669714 TGTAGGAGACAGAAGCAGGGAGG + Intronic
1143574513 17:7782979-7783001 TGGAGGTCACAGGATGATGGTGG + Intronic
1143781393 17:9231397-9231419 TGGGGGCCACAGCAGGGTGGGGG - Intronic
1143794694 17:9327233-9327255 AGGAGGACAGAGGAGGAAGGAGG + Intronic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1145106735 17:20124089-20124111 TGGATGCCACAGAAGGAGGAGGG + Intronic
1146137915 17:30339549-30339571 TGGAGGGCAAAGAAGAAAGGAGG - Intergenic
1146178097 17:30679567-30679589 GGGAGGACAGAGAAGGCAGGAGG + Intergenic
1146186450 17:30727528-30727550 TGGAGGGCCTGGAAGGATGGTGG + Intergenic
1146461316 17:33048130-33048152 TTGAGGACACAGCAAGAAGGTGG + Intronic
1146693606 17:34892977-34892999 TGGGGGAGCCAGAAGGAAGGGGG - Intergenic
1146803354 17:35844865-35844887 TGGAGGAGACAGAAGCCGGGGGG + Exonic
1147261296 17:39210942-39210964 TGGAAGACAGACAAGGAAGGTGG - Exonic
1147684341 17:42277606-42277628 TGGAGGCCAGAGAAGGAAGCAGG + Intergenic
1147708708 17:42447456-42447478 GGGAGGACACAGCAAGAAGGTGG - Intergenic
1147984449 17:44297092-44297114 TGAAGAACACAGTAGGCTGGAGG + Intergenic
1148676766 17:49450217-49450239 TGGAGGCCAAAGCAGGTTGGTGG - Intronic
1149115291 17:53086914-53086936 TGGCGGACACAGCAAGATGGGGG - Intergenic
1149544838 17:57495706-57495728 TTGAGGACAGAGAAGGTTTGGGG - Intronic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1151345740 17:73500268-73500290 AGGAGGATGGAGAAGGATGGAGG - Intronic
1151345747 17:73500298-73500320 AGGAGGATGGAGAAGGATGGAGG - Intronic
1151345764 17:73500359-73500381 GGGAGGATGGAGAAGGATGGAGG - Intronic
1151345819 17:73500594-73500616 TGGAGGAGATAGAAGGAGGATGG - Intronic
1151345842 17:73500695-73500717 TGGAGGAGACGGAAGGAGGATGG - Intronic
1151412100 17:73937739-73937761 GGGAGGACACAGCAAGAAGGTGG + Intergenic
1151941671 17:77296118-77296140 CGGAGGACACAGCAGGGAGGTGG + Intronic
1152275134 17:79352078-79352100 GGCAGGACACAGAAGGAGGTGGG - Intronic
1152367496 17:79865045-79865067 TGGAGGAAGCAGAGGGATCGGGG - Intergenic
1153236192 18:2990871-2990893 AGGAGGACCCAGAAGACTGGAGG - Intronic
1153672753 18:7428112-7428134 TTGGGCACACAGAAGCATGGGGG + Intergenic
1154067978 18:11127055-11127077 TGGAGGAGAGAGAAGGAGGCAGG + Intronic
1155012323 18:21792187-21792209 AGGAGGACACAGCAAGGTGGAGG - Intronic
1155024907 18:21932396-21932418 TGGATGACAGAGAAGGTTTGTGG + Intergenic
1155106860 18:22675561-22675583 TGGTGGACACAAAAAGATGAGGG - Intergenic
1155300600 18:24426183-24426205 TGGAGAACAGAGAAGGCAGGCGG - Intergenic
1155501466 18:26491228-26491250 AGGAGGGCACAGCAGGAGGGTGG + Intronic
1155592043 18:27438513-27438535 TGGAGGAGGCAGAAGGTGGGAGG + Intergenic
1155748481 18:29390637-29390659 TGGAGGGCACAGAAGAAAAGAGG + Intergenic
1155965045 18:32027876-32027898 TTGAGGTTACAGAAGAATGGGGG + Intronic
1156435198 18:37119498-37119520 TGGTGGACACAGCAAGAAGGTGG - Intronic
1156456340 18:37296772-37296794 AGGAGGACATAGAATGATGCTGG - Intronic
1156657380 18:39305020-39305042 TGGAGAACCAAGAAGGCTGGTGG - Intergenic
1156950684 18:42893410-42893432 TTGAGGACACAGCAAGAAGGTGG - Intronic
1158266083 18:55662054-55662076 TGGAAGGCACAGAGGGGTGGGGG - Intronic
1158342714 18:56484137-56484159 TGGATGAGTCTGAAGGATGGGGG - Intergenic
1158582538 18:58697138-58697160 AGGAGGATAGAGAGGGATGGGGG - Intronic
1159037321 18:63290039-63290061 TGGAGGGCAGTGAAGGATGCTGG + Intronic
1159083301 18:63759854-63759876 TGGAGGCCTCAGAATCATGGGGG - Intronic
1159559782 18:69981326-69981348 TGGAGGAGGCAGACGGATAGTGG + Intergenic
1159930155 18:74303603-74303625 TGAAGAACAAAGAAGGTTGGAGG - Intergenic
1160309727 18:77778294-77778316 TGGAGGACCCTGAAGCTTGGAGG + Intergenic
1160675662 19:389974-389996 CGGAGGACAGAGAAAGAGGGAGG - Intergenic
1160732226 19:646515-646537 TGGAGGACACCGAGGTAGGGAGG - Intergenic
1160858452 19:1227675-1227697 TGGTCGGCACAGAAGCATGGCGG - Exonic
1160962337 19:1728475-1728497 TGCAGGACACAGAAGCTGGGAGG - Intergenic
1161031117 19:2058151-2058173 TGGAGCACACAGAAGGTTCAGGG + Intergenic
1161265348 19:3361095-3361117 TGGGGGACCCCGAAGGCTGGGGG - Intronic
1161334629 19:3706127-3706149 GGGAAGGCACAGAAGGCTGGTGG - Intergenic
1161610460 19:5239079-5239101 AGAAGGACAGAGAGGGATGGGGG + Intronic
1161705092 19:5816313-5816335 TGAAGGACAAAGACAGATGGAGG - Intergenic
1162498681 19:11038443-11038465 TGGAGGGCACAGCAGGCAGGAGG - Intronic
1162980469 19:14235851-14235873 GGGAGGACACAGGAGGGGGGAGG - Intergenic
1163056916 19:14726870-14726892 TGGAGGGCTCAGAAGGAAGAAGG - Intronic
1163204878 19:15795134-15795156 TGTAGGTCAGAGAAGGAGGGAGG - Intergenic
1163453015 19:17390455-17390477 TGGAGGACACATATGGGGGGGGG - Intergenic
1164137514 19:22427879-22427901 CGGGGGCCACAGAAGGATAGGGG - Intronic
1164469310 19:28516045-28516067 GGAAGAACACAGCAGGATGGTGG + Intergenic
1164813899 19:31179477-31179499 TGGAGTACAGAGCAGGGTGGAGG + Intergenic
1165914961 19:39252865-39252887 TGGAGGAAACAGATGAATTGTGG + Intergenic
1166802180 19:45465155-45465177 TGGATGAGACAGAAGAATGAGGG + Intronic
1167687912 19:50968159-50968181 GGGAGCAGACAGAGGGATGGGGG - Intronic
1168526087 19:57089878-57089900 TGGAGGACACGGAGGGAAGACGG + Intergenic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
924996673 2:367645-367667 TGGTGGAGACAGAAGGGTGGGGG + Intergenic
925062983 2:907594-907616 TGGGGGACAGAGAAAGAAGGAGG + Intergenic
925263756 2:2549978-2550000 TGGAGGATACTGAAGAATAGGGG + Intergenic
925456295 2:4019331-4019353 TGGAGGACTCAGAAGAAGGCAGG - Intergenic
925537497 2:4933214-4933236 GGGAGGACTCAGAATCATGGCGG - Intergenic
925691539 2:6529096-6529118 AGGAGGTCACATAAAGATGGCGG - Intergenic
926386020 2:12336525-12336547 TTCAGGACCCAGAAGGAAGGTGG + Intergenic
926636606 2:15186802-15186824 TGGAGAACAAGGAAGGATTGGGG - Exonic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927618352 2:24623737-24623759 GTGAGGACACAGGAAGATGGCGG - Intronic
927975353 2:27334473-27334495 TGGATGACACAGGAGGAAGGAGG - Intronic
928220343 2:29398122-29398144 TGCAGGAGCCAGAAAGATGGGGG + Intronic
930301277 2:49618968-49618990 TGGGGGAAACAGGAGGTTGGGGG + Intergenic
930739149 2:54811463-54811485 TGGAGGATGGAGAAAGATGGAGG - Intronic
931210199 2:60186476-60186498 GTGAGGACACAGAAGAAAGGTGG - Intergenic
931646949 2:64432378-64432400 TGAAGGAGACAGCAGAATGGAGG - Intergenic
931701443 2:64912527-64912549 TTCAGGATACAGCAGGATGGAGG + Intergenic
931768737 2:65479512-65479534 TGGAAGACAGACAAGGATGAAGG + Intergenic
932329990 2:70893046-70893068 TTGAGGAGATAGAAGGCTGGGGG + Intergenic
932362601 2:71121443-71121465 TGGAGGGCAGAGAATGATGATGG + Intronic
932858187 2:75260699-75260721 TGGAGGACAGAGAAGGGAGCAGG + Intergenic
932875459 2:75446691-75446713 GGGAGGAGGCAGAAGGATAGGGG - Intergenic
934913452 2:98279188-98279210 TGGAGGAAACTGAAAGAAGGGGG + Intronic
934939162 2:98487710-98487732 TGAAGAACAAAGAAGGTTGGAGG + Intronic
935038879 2:99406317-99406339 AGGAGCACAAAGAAGGTTGGTGG - Exonic
935334764 2:102006232-102006254 AGGAGGACACAGCAGCTTGGTGG + Intronic
935629008 2:105196718-105196740 TTAAGGACACAGGAGGCTGGGGG - Intergenic
935878327 2:107536175-107536197 TGGAGCCCACAGCAGGGTGGAGG + Intergenic
936792500 2:116165821-116165843 TGGAGGCCTCAGAATCATGGCGG - Intergenic
937439490 2:121904078-121904100 TGTGGGACCCAGCAGGATGGTGG + Intergenic
937439738 2:121905693-121905715 TGCGGGACCCAGCAGGATGGTGG + Intergenic
938977755 2:136495559-136495581 TGGAGGATAGAGTAGGAGGGAGG - Intergenic
939155994 2:138524932-138524954 TGGAGGGCTCAGAAGGAGGCAGG - Intronic
939647474 2:144718276-144718298 TGGAGAACAGAGAAGGAATGAGG + Intergenic
940005901 2:149009435-149009457 TAGGGGACCCAGATGGATGGAGG - Intronic
940131531 2:150388020-150388042 GGGAGGCCACAGAGGGATTGGGG + Intergenic
942497010 2:176550415-176550437 GGCAGGTCACAGAAGGATGATGG - Intergenic
942783524 2:179673613-179673635 TGAAGGAGGCAGAAGGAAGGGGG - Intronic
944659581 2:201910257-201910279 TGGAGAGCACAGCATGATGGGGG - Intergenic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945714631 2:213343005-213343027 TGGTGTACACAGAAGGAAGGAGG + Intronic
945782300 2:214190756-214190778 GAGAGGACACAGAAAGAAGGTGG + Intronic
946027699 2:216681756-216681778 TGGGGGACACAGAAGCATGGTGG + Intronic
946230100 2:218285997-218286019 TGGAGGCTAGAGAAGAATGGAGG + Intronic
946881362 2:224180272-224180294 GGCAGGAGACAGAGGGATGGTGG + Intergenic
947140210 2:227013550-227013572 GTGAGGACACAGGAAGATGGTGG + Intronic
947701416 2:232237705-232237727 TGGAGGAGACAGACAGGTGGAGG + Intronic
948063431 2:235058876-235058898 TTGACCACACAGAAGGATGCAGG - Intergenic
948471307 2:238182074-238182096 ATGAGGATACAGAAGGCTGGAGG - Exonic
948769723 2:240245355-240245377 TGGAGGACAAACCAAGATGGCGG - Intergenic
948885926 2:240884637-240884659 TGGGGGACTCAGAAGGCTGTTGG - Intergenic
949075931 2:242057877-242057899 TGGAGGACACAGGAGCATGAGGG + Intergenic
1168873138 20:1147862-1147884 GGGAGGCCACAGCAGGAAGGAGG + Intronic
1169081080 20:2798106-2798128 AGGAGGTCACAGAAGGACTGGGG - Intronic
1169409143 20:5352379-5352401 TGGAGGCCTCAGAATCATGGCGG + Intergenic
1170882900 20:20313214-20313236 GTGAGGACACAGCAGGAAGGTGG + Intronic
1171345625 20:24464129-24464151 TGGAGGACAGAGGCTGATGGAGG + Intergenic
1171364331 20:24613529-24613551 TGGGGGACACAGGAGGCTTGGGG - Intronic
1172050259 20:32111819-32111841 AGGAACACACAGAAGGCTGGAGG + Intronic
1172192399 20:33069802-33069824 TGGACGGAACAGATGGATGGAGG + Intronic
1173226661 20:41166168-41166190 TGGAAGACACAGAGTGAGGGAGG - Intronic
1173264027 20:41461581-41461603 GGGAGGACTCAGAATCATGGCGG - Intronic
1173518069 20:43679094-43679116 TGGGGAACACAGAAGGAAGCAGG + Intronic
1175124227 20:56739593-56739615 AGGAGGACAAAGGAGGAGGGAGG - Intergenic
1175212415 20:57369216-57369238 TTGAGGTCACAGAAAGAAGGGGG + Intronic
1175345345 20:58268964-58268986 TGGAGGACACTGAAGGGCTGGGG + Intergenic
1176270103 20:64231889-64231911 TGGAGGGCACGGAAAGAAGGTGG + Intronic
1177048605 21:16203038-16203060 TGGATGAGAAACAAGGATGGTGG - Intergenic
1177487570 21:21778757-21778779 TGGAGGACACAGAAGAAGACCGG - Intergenic
1177507921 21:22041299-22041321 GGGAAGACACAGAAGGAAGCTGG - Intergenic
1178135864 21:29626487-29626509 GGGAGGACACAGCAAGAAGGTGG + Intronic
1178304621 21:31481158-31481180 GTGAGGACACAGAAAGAAGGTGG - Intronic
1179254137 21:39700233-39700255 TGGAGGAGAGAGAATGAGGGAGG - Intergenic
1179316618 21:40249441-40249463 TGGAGGCCTCAGAATCATGGTGG - Intronic
1179540860 21:42082606-42082628 AGGAGGACACAGAGGGAGGAGGG - Intronic
1180086263 21:45509284-45509306 AGGAGGACACAGATGGAGGAGGG + Intronic
1180256032 21:46628221-46628243 TTGAGGACACAGCAAGAAGGTGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181049160 22:20230623-20230645 TGGAGGGCACACAACGCTGGTGG + Intergenic
1181508040 22:23374903-23374925 TGGGAGCCACAGAAGAATGGAGG - Intergenic
1181624775 22:24115831-24115853 TGGAGGAAGCAGCAGGCTGGTGG - Intronic
1181936071 22:26439826-26439848 TGGAGGAGACAGAAGGACGGAGG - Intronic
1183602640 22:38849021-38849043 TAGAGGAGAGGGAAGGATGGAGG - Intergenic
1184093690 22:42305373-42305395 AGGAGGACCAAGAAGGATGCTGG - Intronic
1184109066 22:42384586-42384608 TGGGGGACAGACAAGGATGATGG - Exonic
1184137897 22:42560161-42560183 GGGGGGAGACAGAAGGATGCTGG - Intronic
1184462886 22:44649268-44649290 GGGAGGCCACGAAAGGATGGAGG + Intergenic
1184946493 22:47807743-47807765 TGGAGCACCCCAAAGGATGGGGG + Intergenic
950885579 3:16359563-16359585 GTGAGGACACAGCAGGAAGGTGG + Intronic
950935236 3:16832731-16832753 AGGAGGACACAGATGCTTGGTGG - Intronic
951147624 3:19247558-19247580 TGCAGGAAAGTGAAGGATGGAGG + Intronic
952553428 3:34504642-34504664 TGGAGAACACAGAAGCAGGCAGG + Intergenic
952681079 3:36093906-36093928 TGAAGCACATAAAAGGATGGTGG + Intergenic
952827217 3:37533904-37533926 TGGAGACCAAAGATGGATGGTGG + Intronic
953545415 3:43860703-43860725 TGGTGGACACATAAGGATGGGGG - Intergenic
953678754 3:45023934-45023956 TGGAGGTCATTGAACGATGGGGG + Intronic
954116705 3:48470552-48470574 GGGAGGACACAGAGGCCTGGAGG + Intronic
954763638 3:52895837-52895859 TGGAGGACAGAGAAGTAGGAGGG + Intronic
954974789 3:54683193-54683215 TTGAGGCTGCAGAAGGATGGTGG - Intronic
955006191 3:54970778-54970800 TGGAGCAGGCAGAAGCATGGTGG + Intronic
956327994 3:68074293-68074315 TGGACCACACAGTAGGAGGGAGG - Intronic
956914908 3:73860750-73860772 TGGAGGACTCAGAAAGAAGAAGG + Intergenic
957066703 3:75528747-75528769 TGGAGGGCTCAGAAGGATACAGG - Intergenic
957470505 3:80652981-80653003 TGAAGGACTCAGAAGGAAGCAGG + Intergenic
957841934 3:85683217-85683239 TGAAGGAAAAAAAAGGATGGAGG + Intronic
958630115 3:96673351-96673373 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
958630119 3:96673384-96673406 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
958630128 3:96673473-96673495 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
958630146 3:96673645-96673667 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
958630150 3:96673680-96673702 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
958630152 3:96673697-96673719 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
958630159 3:96673773-96673795 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
958630161 3:96673790-96673812 TGGAGGAGAGAGAGAGATGGAGG - Intergenic
959111945 3:102133072-102133094 TGGAGGACAAAGATGTAAGGAGG - Intronic
959614799 3:108335298-108335320 TGGATGAAACAGCAGTATGGTGG - Intronic
960080425 3:113534448-113534470 TGGAGGACAGAGCAGGGTGAGGG - Intronic
960130384 3:114049620-114049642 TGAAGGATAAAGAAGGATAGAGG + Intronic
960208913 3:114936119-114936141 TGGAGGAAACACAATAATGGAGG + Intronic
960861414 3:122157901-122157923 TGGAGGAAACAGAAGGACTTTGG - Intergenic
961798263 3:129425328-129425350 TGTAGGCCACAGAAGGAGGCGGG - Intronic
962288058 3:134105228-134105250 TGGAGGACACAGAAGCAACAAGG - Intronic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
963141472 3:141949467-141949489 TGGAGGACACAGACTGACAGCGG + Intergenic
963422183 3:145074103-145074125 TGGAGGCCTCAGAAGGATACAGG - Intergenic
963466847 3:145692858-145692880 TTGAAAACACAGAAGGGTGGAGG + Intergenic
963680706 3:148372121-148372143 TGGAGGACACTGAAGTGGGGCGG - Intergenic
964488837 3:157213292-157213314 AGGAGGGCACAGAAGGAAGATGG + Intergenic
964792910 3:160469833-160469855 TGGAGGACTCAGAAGAAGGCAGG + Intronic
965230412 3:166043825-166043847 TGGAGGTAAAGGAAGGATGGAGG + Intergenic
965504852 3:169503565-169503587 TGGAGGACACAGAAGTCTAAGGG - Intronic
965529459 3:169756739-169756761 TGGATGACTCAGAATCATGGTGG + Intergenic
965559094 3:170044784-170044806 TGGTAGGCAGAGAAGGATGGGGG - Intronic
966427739 3:179798427-179798449 AGGAGGAGACAGAGGGATAGGGG - Exonic
966499305 3:180620921-180620943 CGGAAGACTCAGAAGCATGGTGG - Intronic
967717002 3:192774401-192774423 TGGAGGCCTCAGAATCATGGTGG - Intergenic
967810307 3:193754211-193754233 TGGAGGACTCAGAAGAAGAGAGG + Intergenic
968266190 3:197365237-197365259 TGGAGGGGACAGTGGGATGGTGG - Intergenic
968789577 4:2650331-2650353 TTGAGAGCACAGAAGGAGGGAGG + Intronic
969075327 4:4573809-4573831 TGGAGCTCACAGAAGCATGGAGG - Intergenic
969134571 4:5019777-5019799 AGGAGGACAGAGATGGAAGGAGG + Intergenic
969145862 4:5123609-5123631 TGGAGGACACAGAGGGAAGGTGG - Intronic
969417847 4:7072719-7072741 TGAAGGACAGGGAAGGAAGGAGG + Intergenic
969425620 4:7122221-7122243 GGGAGGACACACAGGGAGGGAGG - Intergenic
970173109 4:13308700-13308722 TGCAGCACACAGAAGGACAGTGG + Intergenic
970252372 4:14129159-14129181 TGGAGGTCACAATAGAATGGAGG + Intergenic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971424757 4:26504723-26504745 ATGAGGACACAGCAAGATGGCGG + Intergenic
971793772 4:31200586-31200608 TGGAGGCCTCAGAATCATGGTGG + Intergenic
972001392 4:34039850-34039872 TGGAGGTCTCAGAATCATGGCGG + Intergenic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972418278 4:38863796-38863818 GGGAGGGGAGAGAAGGATGGAGG - Intergenic
974166724 4:58213942-58213964 TTGAGAATACAGAAGGATTGGGG + Intergenic
975253824 4:72212081-72212103 GGGAGGCCACAGAATCATGGAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976222262 4:82766191-82766213 TGGAGTCCACAGAATGGTGGTGG - Intronic
976441018 4:85074509-85074531 TTGAGGACACAAAAGGATCTGGG - Intergenic
976798143 4:88957643-88957665 TGGAGGACACAGAAGAAGATAGG + Intronic
977953615 4:103001697-103001719 TGGAGGGCTCAGAAGAATAGAGG - Intronic
978188894 4:105890796-105890818 TGGAGGAAAAGGAAGTATGGAGG - Intronic
979436809 4:120702986-120703008 TGGGGGAAAGAGAAGGCTGGTGG - Intronic
979728891 4:123997869-123997891 GGGAGGACACAGTGAGATGGTGG - Intergenic
980478754 4:133357162-133357184 GGGAGGCCACAGAATCATGGTGG + Intergenic
980637683 4:135529871-135529893 TGGGGGATAGAGAAGGATGCAGG + Intergenic
981190481 4:141856518-141856540 TGGATGTCAGAGAAGGAAGGAGG + Intergenic
982415618 4:155128030-155128052 GGGAGGCCACAGAATCATGGTGG + Intergenic
983568155 4:169176050-169176072 TGGAGCACACAGTAAGAAGGTGG + Intronic
983882718 4:172951393-172951415 TGAAGGAAGCAGAAGGTTGGTGG - Intronic
984017456 4:174442698-174442720 TGGAGGCCTCAGAATCATGGTGG + Intergenic
985171450 4:187154335-187154357 TGGAGAACAGAAAATGATGGTGG + Intergenic
986001896 5:3637187-3637209 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001900 5:3637220-3637242 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001906 5:3637253-3637275 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001916 5:3637319-3637341 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001921 5:3637352-3637374 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001926 5:3637385-3637407 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001933 5:3637451-3637473 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001939 5:3637484-3637506 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001944 5:3637517-3637539 TGCAAGACACAGAAGGATGCTGG - Intergenic
986001948 5:3637550-3637572 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001956 5:3637616-3637638 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001960 5:3637649-3637671 TGCAAGACACAGAAGGATGCTGG - Intergenic
986001965 5:3637682-3637704 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001970 5:3637715-3637737 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001975 5:3637748-3637770 TGCAAGACACAGAAGGATGCTGG - Intergenic
986001979 5:3637781-3637803 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001988 5:3637847-3637869 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001991 5:3637880-3637902 TGCAAGACACAGAGGGATGCTGG - Intergenic
986001996 5:3637913-3637935 TGCAAGACACAGAGGGATGCTGG - Intergenic
986002050 5:3638276-3638298 TGCAAGACACAGAGGGATGCTGG - Intergenic
986002060 5:3638342-3638364 TGCAAGACACAGAGGGATGCTGG - Intergenic
986002065 5:3638375-3638397 TGCAAGACACAGAGGGATGCTGG - Intergenic
986002070 5:3638408-3638430 TGCAAGACACAGAGGGATGCTGG - Intergenic
986002085 5:3638507-3638529 TGCAAGACACAGAGGGATGCTGG - Intergenic
986002115 5:3638705-3638727 TGCAAGACACAGAGGGATGCTGG - Intergenic
986002195 5:3639233-3639255 TGCAAGACACAGAGGGATGCTGG - Intergenic
986113779 5:4749647-4749669 GGGAGGCCTCAGAATGATGGCGG + Intergenic
986486000 5:8237751-8237773 TGAAGGACACATAAGGAAAGGGG + Intergenic
986493276 5:8315969-8315991 TGAAGGACACAGGCTGATGGAGG - Intergenic
986604562 5:9508696-9508718 TGGAGCACAGAGCAGGACGGTGG - Intronic
986720243 5:10555944-10555966 GGGAGGACACAGCAGGAGGATGG + Intergenic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
986911469 5:12563956-12563978 TGGAGGCCTCACAAGTATGGTGG + Intergenic
988070620 5:26284280-26284302 GGGAGGACACACAATCATGGAGG + Intergenic
988398742 5:30732739-30732761 TGGAGGCCCAAGAAGGCTGGTGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988777688 5:34491704-34491726 TGGGGGACAAATAAAGATGGTGG + Intergenic
988927911 5:36007756-36007778 TGGAGGACTCAGAAGAATATAGG - Intergenic
989069639 5:37497209-37497231 GGGAGGACGGAGGAGGATGGAGG - Intronic
989182201 5:38589752-38589774 TCGAGGACAAAGAAGGAGGGAGG - Intronic
990118371 5:52417718-52417740 TAGAGGACACAGGTGGATGGGGG - Intergenic
990937098 5:61162587-61162609 TGGAGGACGCGGGAGGGTGGGGG + Intergenic
990990518 5:61679042-61679064 TGGGTGGCACAGAAGGAAGGAGG + Intronic
991508632 5:67352457-67352479 TGGAGGTTTCAGAAGTATGGGGG - Intergenic
991996425 5:72391521-72391543 ATGAGGACACAGAAAGAAGGTGG + Intergenic
992941441 5:81766302-81766324 TGGAGGAAAAAGGAGGAAGGAGG + Intergenic
993304440 5:86257545-86257567 GGGAGGACTCAGAATCATGGAGG + Intergenic
993309573 5:86312937-86312959 GGGAGGACTCAGAATCATGGTGG - Intergenic
993410763 5:87570437-87570459 GGGAGGACACAGCAAGAAGGTGG + Intergenic
994984991 5:106921105-106921127 GTGAGGACACAGAAAGAAGGTGG - Intergenic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
995847589 5:116510701-116510723 TGGGGGAGAGAGAAGGAGGGAGG - Intronic
995849079 5:116525583-116525605 TGCAAGACACAGAAGGCTGTGGG - Intronic
996112621 5:119583325-119583347 TGGAGAACAAAGAGGGAAGGTGG - Intronic
996230185 5:121053697-121053719 GGGAAGAAACTGAAGGATGGAGG + Intergenic
996248670 5:121299388-121299410 GGGAGGATACAGAAAGAAGGTGG - Intergenic
996522147 5:124438971-124438993 TGAAGGAAACAGAACAATGGGGG + Intergenic
996526716 5:124488246-124488268 TGGAGGCCTCAGAATCATGGCGG + Intergenic
997286321 5:132681301-132681323 TTGAGGACACTCAAGGAGGGAGG + Intronic
997330395 5:133056149-133056171 TGGAGGTCACAGTAGGTTTGAGG + Intronic
997380146 5:133429793-133429815 GGGAGGTCACTGAGGGATGGTGG - Intronic
997528833 5:134570014-134570036 AGCAGGACAAAGAAGGGTGGAGG - Intronic
997870669 5:137502684-137502706 AGGAGAACACAGAGGCATGGAGG - Intronic
998610976 5:143687897-143687919 TGGAATACACAGAAGAATTGGGG - Intergenic
998821811 5:146064099-146064121 GGTAGGACAAAGAAGGCTGGAGG + Intronic
999368151 5:151036271-151036293 TGAGGGACACAGAAGGATTGGGG - Intronic
999739402 5:154538652-154538674 TCAAGGACACTGAGGGATGGAGG - Intergenic
1000137142 5:158363775-158363797 AAGTGGACACAGAGGGATGGTGG + Intergenic
1000249502 5:159480595-159480617 GATAGGCCACAGAAGGATGGAGG - Intergenic
1001031337 5:168265561-168265583 AGAAGGACACAGAAGGTGGGTGG + Intergenic
1001250585 5:170143913-170143935 TGCAGGACACAGAAAGGAGGTGG + Intergenic
1001574430 5:172752819-172752841 TGGAGGACACAGAAAGAGTTGGG + Intergenic
1001626616 5:173141198-173141220 TGAAGGACACAGAAGGAAACTGG + Intergenic
1002193601 5:177491077-177491099 TGGAGAACACAGAGGACTGGCGG - Exonic
1002311550 5:178318265-178318287 TGGAAGGCACCGAAGGCTGGGGG - Intronic
1002682295 5:180976168-180976190 AGGAGGAAACACAAGGAAGGTGG - Intergenic
1003311191 6:4971215-4971237 GTGAGGACACAGCAGGAAGGTGG - Intergenic
1003406985 6:5833970-5833992 TGGAGAACAGAGGAGGAGGGGGG + Intergenic
1003659464 6:8046257-8046279 GGGAGGACTCAGAATCATGGTGG - Intronic
1003907799 6:10718635-10718657 TGCAGGACACAGCAGTAAGGAGG - Intergenic
1004288929 6:14348971-14348993 GTGAGGACACAGCAGGAAGGCGG - Intergenic
1004298960 6:14439849-14439871 TGGAAGACACAGAGAGAAGGCGG - Intergenic
1005380482 6:25229288-25229310 TGGAGAACACAGCAAGATGATGG + Intergenic
1006339011 6:33435766-33435788 TGGGGGACTCAGAATAATGGGGG - Intronic
1006586396 6:35117388-35117410 TGGAGAAGCCAGAAGGATGGAGG + Intergenic
1007017772 6:38486543-38486565 TGGAGGACAGGGAGAGATGGGGG + Intronic
1007295843 6:40819938-40819960 TGGAGGGCAGAGAAAGGTGGAGG + Intergenic
1007359793 6:41346730-41346752 GGGAGGACAGAGAATGATGTGGG - Intronic
1007369391 6:41416462-41416484 TGAAGGACACAGGAAGGTGGAGG + Intergenic
1007923824 6:45635016-45635038 GGCAGGACACAGAAGGCTGGTGG + Intronic
1008048218 6:46873277-46873299 TGGCAAACACAGAAGCATGGTGG - Intronic
1008460574 6:51765124-51765146 TGGAGCACACTGATGAATGGAGG - Intronic
1009357721 6:62772272-62772294 TGGAGGAGAGTGAAGGATTGAGG - Intergenic
1010927249 6:81757381-81757403 TGGGGGACAGACAAGGGTGGGGG - Intergenic
1011900240 6:92285708-92285730 TGGAGGATACTGAAGACTGGAGG + Intergenic
1013479777 6:110543737-110543759 TGGAGGAAGCAGGAGCATGGAGG + Intergenic
1014074211 6:117218164-117218186 GTAAGGACACAGAAGGAAGGTGG - Intergenic
1014703798 6:124722005-124722027 TGGAGGAGAAAGTAGAATGGTGG - Intronic
1014707205 6:124762222-124762244 ATGAGGACACAGAAAGAAGGTGG - Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015570033 6:134611433-134611455 TCAAGGACAAAGAAGCATGGAGG - Intergenic
1016792029 6:148076106-148076128 TGTAGGAAACAGAAGGAGAGTGG - Intergenic
1017333227 6:153224000-153224022 GGGAGGACACAGAGAGAAGGTGG + Intergenic
1017456672 6:154606974-154606996 TGGAAGCCAAGGAAGGATGGGGG - Intergenic
1017525086 6:155235345-155235367 AGGAGTGCACAGAAGGCTGGGGG + Intronic
1017677131 6:156826195-156826217 TGGAGGACACAGGAGGAAAGAGG - Intronic
1018358159 6:163039465-163039487 TGGAGGACTCAGAAGAAGAGAGG + Intronic
1018386991 6:163313727-163313749 GGGAGGACCCAGTAGGATGAGGG - Intronic
1018488878 6:164271663-164271685 TAGAGGACACTGAAGAATAGAGG + Intergenic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1018925550 6:168204296-168204318 TAGAGGATACAGGGGGATGGGGG + Intergenic
1019273992 7:166342-166364 TGGGGGACACAGCAGGACGCAGG + Intergenic
1019897412 7:3993291-3993313 TGGCTGAAACAGAAGAATGGTGG + Intronic
1020680626 7:11232540-11232562 TGGAGGACACTGAAAAATGTAGG + Intergenic
1020684111 7:11272367-11272389 TAGAGGACACTGCATGATGGAGG + Intergenic
1021121113 7:16796830-16796852 TGGGGGACAGAGAAGGAAGTGGG + Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1022397297 7:30000741-30000763 GGGAGGCCACAGAATCATGGCGG + Intergenic
1022521079 7:31007242-31007264 TAGAGAACTCACAAGGATGGGGG + Intergenic
1023055300 7:36285707-36285729 TGGAGCACACAGAAAGCAGGGGG - Intronic
1023733496 7:43214860-43214882 TGGAACACACAGAAGACTGGAGG - Intronic
1023863114 7:44227126-44227148 TGGAGGACAGAGGGGGATGTGGG + Intronic
1023863240 7:44227493-44227515 TGGAGGACAGAGGAGGGTGTGGG + Intronic
1024383783 7:48727793-48727815 GGTAGGACAGAGAAGCATGGTGG + Intergenic
1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG + Intronic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1026116793 7:67502599-67502621 ATGAGGACACAGCAGGAAGGTGG - Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026478956 7:70762666-70762688 TGGTGGACAGAGAAAGATGCAGG - Intronic
1026579144 7:71599487-71599509 AAGAGGACACAGAATGATGCGGG - Intronic
1026791504 7:73335503-73335525 TGGAGCAGACAGCAGGAAGGTGG - Intronic
1026794056 7:73354479-73354501 TGGAGGACCCAGCAGGCCGGAGG + Intronic
1026864423 7:73814460-73814482 CGCAGGACACAGAAGCTTGGTGG - Intronic
1026883697 7:73923446-73923468 GTGAGGACACAGCAAGATGGCGG - Intergenic
1027704513 7:81511405-81511427 TGGAGGTCTCAGAATCATGGCGG - Intergenic
1027733798 7:81907372-81907394 TGGAGGTCACTGAATCATGGAGG - Intergenic
1028153797 7:87406762-87406784 AGTAGGACACAGATGGCTGGAGG - Intronic
1028732785 7:94171414-94171436 TGGAAGCCACAGAAGAATGTGGG + Intergenic
1029438402 7:100574786-100574808 GGGAGGGCACAGGAGGAAGGGGG + Exonic
1029731358 7:102440335-102440357 GGGATGACTCAGAAGGAAGGCGG - Intronic
1030367716 7:108664549-108664571 TTGAGGAGACTGAAGGATTGAGG - Intergenic
1030503863 7:110395164-110395186 TGGAAGAAAGAGAAGGAGGGAGG + Intergenic
1031088455 7:117324862-117324884 TGCGGGACAAAGAAGGGTGGAGG - Intergenic
1031636969 7:124113187-124113209 TGGAGGACATAGGAGGAAGTTGG + Intergenic
1031662599 7:124444822-124444844 TGGAGGACAGAAAAGCAAGGAGG - Intergenic
1032355666 7:131208184-131208206 AGGAGGACACAGGAGGAAAGAGG + Intronic
1032762453 7:134956506-134956528 ATGAGGACACAGCAGGAAGGTGG + Intronic
1032877595 7:136054144-136054166 AGGAGGACACAGACGGAGTGGGG + Intergenic
1033086461 7:138346425-138346447 TGGAGGAAACAGAAGCTGGGAGG + Intergenic
1033129964 7:138737395-138737417 GGGAGGCCACACAATGATGGTGG - Intronic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1034277524 7:149830228-149830250 GGGAGGACACAGGAGGAGGAGGG - Intergenic
1034975658 7:155448121-155448143 TGGAGGACGCAGGAGTATGGGGG + Intergenic
1035004447 7:155644769-155644791 CGGAGGACAGAGAAGGGAGGGGG - Exonic
1035582211 8:747502-747524 CGGAGGACACAGGCGGCTGGAGG + Intergenic
1035951910 8:4031101-4031123 TGGAGGACTCAGAAGGAGACAGG - Intronic
1037637753 8:20715648-20715670 TGGAGGACAGAGAAGCAAGAGGG + Intergenic
1037642005 8:20753390-20753412 GGGAGGCCACACAATGATGGTGG - Intergenic
1037844552 8:22271610-22271632 GTGAGGACACAGCAAGATGGCGG - Intergenic
1038276680 8:26127195-26127217 GGGAGGACACAGCAAGAGGGCGG - Intergenic
1038433920 8:27521472-27521494 TGGAGGACAGAGAAGGATGATGG + Intronic
1038769605 8:30465304-30465326 TGTCAGACACAGAAGGAGGGAGG - Intronic
1039309140 8:36297019-36297041 TGGAAGAAACAGAAAGATGTGGG + Intergenic
1041774142 8:61505532-61505554 GGGAGGACTCAGAATCATGGTGG - Intronic
1042845657 8:73167448-73167470 TGGAGGACAGAGCGGGGTGGGGG + Intergenic
1043061450 8:75509667-75509689 TGGACCACATATAAGGATGGTGG + Intronic
1043423312 8:80122811-80122833 TGGAGTACACAGAGGGAAGAAGG + Intronic
1044327518 8:90876223-90876245 AGGAGGACACAGCAGTCTGGAGG - Intronic
1044538741 8:93386519-93386541 AGCAGGACACAGGACGATGGTGG + Intergenic
1045646942 8:104308454-104308476 GTGAGGACACAGCAGGAAGGCGG + Intergenic
1046178905 8:110616594-110616616 TGCAGGCCACAGAGTGATGGGGG - Intergenic
1046284156 8:112073747-112073769 GGCAGGACACAGAATGGTGGGGG - Intergenic
1047313202 8:123709442-123709464 AGGAAGACAGAGAAGGAGGGAGG - Intronic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048550241 8:135427190-135427212 TGGAGGGCACAGGAGGCTGGAGG + Intergenic
1048675248 8:136770706-136770728 TGGAGGGCTCAGAAGGATACAGG - Intergenic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1049174713 8:141184778-141184800 AGGTGGACACAGAGGGAGGGAGG - Intronic
1049326300 8:142023252-142023274 TGGAGGACAGACAAAGAAGGAGG - Intergenic
1049847150 8:144808352-144808374 GGGAGGACACAGAGGGCAGGCGG + Exonic
1050496059 9:6243744-6243766 TGGAGGATAAGGAATGATGGTGG + Intronic
1051278354 9:15418083-15418105 GGGAGGAGACAGAAGGAAGAAGG - Intergenic
1051368030 9:16335001-16335023 TGTACGATACAGAATGATGGAGG + Intergenic
1051644264 9:19251920-19251942 TGGAGGGCTCAGAAGGAGAGAGG - Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051872266 9:21752067-21752089 TAGAGAACACTGGAGGATGGGGG + Intergenic
1052766896 9:32650669-32650691 TGGAGCACCCAGCAGGAGGGTGG + Intergenic
1053480877 9:38415396-38415418 GGGAGGAGACAGAAGGCAGGAGG + Intronic
1053481947 9:38422658-38422680 TGGAGGACAGAGCTGGCTGGGGG - Intronic
1053599320 9:39594069-39594091 TGGAAGAGACAGAGGGAGGGTGG - Intergenic
1053857025 9:42348255-42348277 TGGAAGAGACAGAGGGAGGGTGG - Intergenic
1054254204 9:62748317-62748339 TGGAAGAGACAGAGGGAGGGTGG + Intergenic
1055878616 9:80971750-80971772 GGGAGGACTCAGAATCATGGTGG - Intergenic
1055946875 9:81699743-81699765 TGGAGGCAACAGTAGAATGGTGG + Intergenic
1056381729 9:86062538-86062560 AAGAGGACAGAGTAGGATGGAGG + Intronic
1056397194 9:86192681-86192703 TGGAGGCCACAGAAGAAGGCTGG + Intergenic
1056579792 9:87882697-87882719 TGGGGGACCCAGGAGGGTGGAGG + Intergenic
1056607370 9:88097431-88097453 TGGAGACCACAGAGGGAGGGGGG + Intergenic
1056630864 9:88291918-88291940 TGGATGACAGAGAAGGTGGGAGG + Intergenic
1056906142 9:90649547-90649569 ATGAGGACACAGCAGGAAGGTGG + Intergenic
1057027050 9:91742099-91742121 TGGAGGCCTCAGAATCATGGTGG + Intronic
1058892316 9:109371481-109371503 TTGAGGACACAGCAGGAAGATGG + Intergenic
1059351451 9:113668182-113668204 TGGGGGAAACAGAATGGTGGTGG - Intergenic
1059572460 9:115454059-115454081 GGGAGGACTCAGAATCATGGTGG - Intergenic
1059765653 9:117381415-117381437 GGGAGGTCACAGAATCATGGGGG + Intronic
1060203585 9:121667915-121667937 GGGAGGACTCAGAATCATGGCGG + Intronic
1060341532 9:122781545-122781567 TAGAGGACTCAGAAGCAAGGTGG + Intergenic
1061012547 9:127964044-127964066 GGGAAGACCCAGAAGGAGGGAGG + Intronic
1061163779 9:128911006-128911028 GGGAGGACTCAGCAGGTTGGTGG - Intronic
1061954375 9:133953878-133953900 GGGAGGACACCTAGGGATGGAGG - Intronic
1062349725 9:136132967-136132989 TGGAGGACATAGGAGTGTGGGGG + Intergenic
1062596030 9:137299999-137300021 TTGAGGACACAGGTGGGTGGAGG - Intergenic
1062689966 9:137836591-137836613 TGGAGAACATAGCAGGCTGGAGG - Intronic
1062690752 9:137841189-137841211 TGGAGGATACGGAGGGACGGTGG - Intronic
1062690759 9:137841214-137841236 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690776 9:137841266-137841288 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690793 9:137841318-137841340 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690801 9:137841343-137841365 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690827 9:137841420-137841442 TGGAGGATACGGAGGGACGGTGG - Intronic
1062690834 9:137841445-137841467 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690887 9:137841597-137841619 TGGAGGATACGGAGGGACGGTGG - Intronic
1062690894 9:137841622-137841644 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690902 9:137841647-137841669 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690946 9:137841774-137841796 TGGAGGATACGGAGGGACGGTGG - Intronic
1062690953 9:137841799-137841821 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690979 9:137841878-137841900 TGGAGGATACAGGGGGACGGTGG - Intronic
1062690987 9:137841903-137841925 TGGAGGATACAGGGGGACGGTGG - Intronic
1062691004 9:137841955-137841977 TGGAGGATACAGGGGGACGGTGG - Intronic
1062691028 9:137842033-137842055 TGGAGGATACAGGGGGACGGTGG - Intronic
1062691044 9:137842085-137842107 TGGAGGATACAGGGGGACGGTGG - Intronic
1062691077 9:137842188-137842210 TGGAGGATACAGGGGGACGGTGG - Intronic
1062691196 9:137842554-137842576 TGGAGGATACAGGGGGACGGTGG - Intronic
1062691229 9:137842656-137842678 TGGAGGATACAGGGGGACGGTGG - Intronic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1187400709 X:18957441-18957463 TGCAGACCACAGGAGGATGGTGG + Intronic
1187581555 X:20612685-20612707 GGGAGGACTCAGATGGTTGGGGG + Intergenic
1187646900 X:21357191-21357213 TGGAGGACCTAGAAGGAATGGGG + Intergenic
1188643382 X:32534647-32534669 GGGAGGACACAGCAAGAAGGAGG - Intronic
1188715854 X:33458111-33458133 TGGAGGGCTCAGAAGAATGCAGG - Intergenic
1188801654 X:34538994-34539016 AGGAGGACAAGGAAGGAGGGAGG + Intergenic
1189005500 X:36989677-36989699 TGGAAGACAGAGAAGTATGCAGG + Intergenic
1189043526 X:37568259-37568281 TGGAAGACAGAGAAGTATGCAGG - Intronic
1189239747 X:39516080-39516102 CGCAGGCCCCAGAAGGATGGGGG - Intergenic
1189316654 X:40061670-40061692 TGTAGGTCACAGAGGGAGGGGGG - Intronic
1189488709 X:41452891-41452913 TGGAGGAAACAGAAGTGCGGAGG - Intronic
1190279599 X:48920891-48920913 TGAAAGACAAAGAAGGTTGGTGG + Intergenic
1192103613 X:68291664-68291686 TTCAGAACACAGAAGGATGTGGG - Intronic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1192527877 X:71863078-71863100 GGGAGGACTCAGAATCATGGCGG + Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193428736 X:81373661-81373683 TGAAGGACACAGATGGATACAGG + Intergenic
1193877174 X:86874406-86874428 TGCAGGACACAGATGGATCTTGG + Intergenic
1194220601 X:91184301-91184323 GGGAGGCCACACAATGATGGTGG - Intergenic
1195164109 X:102200900-102200922 TGAAAGACACAGAAGAATTGTGG + Intergenic
1195194751 X:102486195-102486217 TGAAAGACACAGAAGAATTGTGG - Intergenic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1195655998 X:107332134-107332156 TGGGGGTGACAGGAGGATGGAGG + Intergenic
1195977793 X:110546454-110546476 AAGAGGACACAGAAAGAAGGTGG + Intergenic
1198011743 X:132563645-132563667 GGGTGGACAAAGAAAGATGGAGG - Intergenic
1198241998 X:134796498-134796520 TGGAGGGAAAACAAGGATGGAGG + Intronic
1198561779 X:137858233-137858255 GGGAGGAAACAGGAGGCTGGGGG + Intergenic
1199494617 X:148439272-148439294 TGGAGCACCCAGATAGATGGTGG + Intergenic
1199737271 X:150695808-150695830 TGGAGTTCACAGAAGAATGATGG + Intronic
1200274381 X:154717943-154717965 TTGAGCACAGAGAAGGATGACGG + Intronic
1200558139 Y:4664123-4664145 TGGGGGAGCCAGAAGGAAGGTGG - Intergenic
1201466634 Y:14288591-14288613 TGCAGGAGACAGAAGGTAGGTGG + Intergenic
1202258443 Y:22944155-22944177 TGGACCACTCAGAAGGATGTGGG + Intergenic
1202411433 Y:24577913-24577935 TGGACCACTCAGAAGGATGTGGG + Intergenic
1202459350 Y:25092159-25092181 TGGACCACTCAGAAGGATGTGGG - Intergenic