ID: 1076803827

View in Genome Browser
Species Human (GRCh38)
Location 10:132845334-132845356
Sequence TCCAGAGATGTCTGCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076803827_1076803831 -6 Left 1076803827 10:132845334-132845356 CCATGTCTGCAGACATCTCTGGA 0: 1
1: 0
2: 3
3: 28
4: 266
Right 1076803831 10:132845351-132845373 TCTGGATGTCACAATGGCAGGGG No data
1076803827_1076803830 -7 Left 1076803827 10:132845334-132845356 CCATGTCTGCAGACATCTCTGGA 0: 1
1: 0
2: 3
3: 28
4: 266
Right 1076803830 10:132845350-132845372 CTCTGGATGTCACAATGGCAGGG No data
1076803827_1076803829 -8 Left 1076803827 10:132845334-132845356 CCATGTCTGCAGACATCTCTGGA 0: 1
1: 0
2: 3
3: 28
4: 266
Right 1076803829 10:132845349-132845371 TCTCTGGATGTCACAATGGCAGG No data
1076803827_1076803833 16 Left 1076803827 10:132845334-132845356 CCATGTCTGCAGACATCTCTGGA 0: 1
1: 0
2: 3
3: 28
4: 266
Right 1076803833 10:132845373-132845395 GTGCTCCTGTCAGCCAGTGGCGG No data
1076803827_1076803832 13 Left 1076803827 10:132845334-132845356 CCATGTCTGCAGACATCTCTGGA 0: 1
1: 0
2: 3
3: 28
4: 266
Right 1076803832 10:132845370-132845392 GGGGTGCTCCTGTCAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076803827 Original CRISPR TCCAGAGATGTCTGCAGACA TGG (reversed) Intronic
900651198 1:3730842-3730864 TCCAGAGGTGTCTGGAGCCTGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902542567 1:17165310-17165332 CCCAGAGGTTCCTGCAGACAGGG - Intergenic
903625995 1:24730466-24730488 GCCTGAGCTGACTGCAGACATGG - Intergenic
904563146 1:31412214-31412236 TCCAGAGGTGGCTGAGGACAGGG + Intronic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906092621 1:43195045-43195067 ACCAGAGATTTCTGAGGACAGGG + Intronic
911444449 1:97972539-97972561 TGCAAAGATGTGTGCATACAGGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913333175 1:117684083-117684105 TCCAGAAATGCCTTCAAACAAGG - Intergenic
917891404 1:179441833-179441855 GCAAGAAATGTCTGCAGACCAGG - Intronic
919000134 1:191820790-191820812 TGAAGAGATGTCTGCAGTCCAGG + Intergenic
919107731 1:193174796-193174818 TCCAGAGATGTCAGCAAGTAAGG - Intronic
920297957 1:204970886-204970908 TCTTGAGATGTCTGAAGAGATGG - Intronic
921731676 1:218586090-218586112 GGCAGTGATGTCTGCAGAAAAGG - Intergenic
922532745 1:226356908-226356930 TCCAGAGATGAAGGCAGGCAGGG - Intergenic
922584756 1:226725260-226725282 AGCACAGGTGTCTGCAGACAAGG + Intronic
924083942 1:240428647-240428669 TCCAGAGCTGCCTGGAGAAATGG - Intronic
1062789229 10:290924-290946 TACAGGGATGACTTCAGACAGGG + Intronic
1062941481 10:1424830-1424852 CCCCGAGATGTTTGAAGACAAGG + Intronic
1065640260 10:27774867-27774889 GCCAGAGATGCCTGAAGAAAAGG - Intergenic
1067040985 10:42953166-42953188 TCCAGAGGGGTCTGCGGAAATGG - Intergenic
1067553529 10:47252315-47252337 TGCAGTGATCTCTGCAGACCTGG - Intergenic
1068433648 10:56963551-56963573 CCCAGAGGTGTGTGTAGACATGG - Intergenic
1068712388 10:60149142-60149164 CCCAGAGATGTGTACACACAAGG + Intronic
1071934809 10:90517056-90517078 TCTAGATATATCTGCAAACAGGG + Intergenic
1072133366 10:92518588-92518610 TCCAGAGAAGTCTGTGTACAAGG + Intronic
1074012289 10:109494690-109494712 TCCAGCCATGCCTGCAGAGAAGG - Intergenic
1074125058 10:110522096-110522118 CCTATAGATGTCTGCAGCCAAGG + Intergenic
1074805693 10:117049157-117049179 GACAGAGATGTTTGCAGTCATGG + Intronic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1076806337 10:132861017-132861039 TCTACAGATGTGTGCAGGCAGGG + Intronic
1078466959 11:11557490-11557512 TCCAGAGCTGTGTGGGGACAGGG - Intronic
1079592606 11:22198240-22198262 TCCAGAGAGGGCTGCATTCAAGG + Intronic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1082898542 11:58219815-58219837 TCCAGAGAGGTCAGCATACTAGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083325970 11:61873205-61873227 TCCAGAAGCGTCCGCAGACATGG + Intergenic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084065148 11:66699726-66699748 CCCAGAGAGCTCTGAAGACAGGG + Intronic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084764751 11:71301113-71301135 TCCAAAGCTGCCTGCAGAGATGG - Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090184562 11:124728237-124728259 TTCAGAGCTGCCTGCAGCCACGG + Intergenic
1090488182 11:127133694-127133716 TACAGATATGTGTGCATACATGG + Intergenic
1093412102 12:18879297-18879319 TCCAGAGGTGCCTGCACACAGGG - Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1098403357 12:70097689-70097711 GTCAGAGCTGTCTGGAGACAAGG - Intergenic
1100039416 12:90295606-90295628 TCCTGAGATGTCAGCAGAGCTGG - Intergenic
1103020743 12:117531832-117531854 TGCAGACATCCCTGCAGACAAGG + Intronic
1103789880 12:123462288-123462310 TCCTGAGATGTTTGCACAAATGG + Intronic
1104054186 12:125216802-125216824 TCCACAGATGTCTGGACCCAGGG + Intronic
1104415528 12:128594259-128594281 TCCCGAGATGTCAGCTGTCACGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106103389 13:26713610-26713632 TCCAGAAATGTCTGGGCACAGGG - Intergenic
1106409285 13:29499817-29499839 GCAAGAGATGTCTGCAAAAAGGG - Intronic
1110665115 13:78107672-78107694 CCCAGAGAATTTTGCAGACATGG - Intergenic
1111041781 13:82757958-82757980 TCCAGAGGTGTTTGTAGAGATGG - Intergenic
1113830165 13:113289502-113289524 TCCAGAGTTGTCTCCAGTAAAGG - Intergenic
1114643388 14:24239921-24239943 TCCAGAGATTCCTGTAGAGAAGG + Exonic
1115503871 14:34075475-34075497 TCAAGAGTTGTCTGCACACGTGG + Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117745897 14:58869370-58869392 GCCAGTGATGACTGCTGACAAGG + Intergenic
1119327218 14:73767699-73767721 TCCAGAGGTGTCTGGACACAGGG - Intronic
1121430106 14:93880483-93880505 TCCACAGAGGTGTGCAAACAGGG - Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122294728 14:100698967-100698989 TCCAGAGCTTTCTGCAGACTGGG + Intergenic
1122420822 14:101575996-101576018 TGCAGAAGTGTCTGCAGATATGG - Intergenic
1124375226 15:29125369-29125391 TACAGAGATGACCGCAGCCAGGG + Intronic
1125747071 15:42004489-42004511 TCCAGAGTTGGCTGCAGAGTTGG + Intronic
1128181548 15:65609893-65609915 TCCAGAGGTGTCTTCAGAGAAGG - Intronic
1128384075 15:67134872-67134894 CTGAGAGATTTCTGCAGACAAGG + Intronic
1129973092 15:79797608-79797630 TCCAGAGCTGTCAGCAGAGCTGG - Intergenic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130199768 15:81814174-81814196 TCCAGAGATGTATGAAGCAATGG + Intergenic
1130699297 15:86162886-86162908 TCCAGTGAAGTCTGGAGACTGGG - Intronic
1131051537 15:89351444-89351466 GGCAGAGATGTCTGCAGAGAGGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1134221556 16:12358787-12358809 TCCAGTGATGTCTCCATAAAAGG + Intronic
1134249393 16:12563765-12563787 TTCAGACAGGTCGGCAGACAAGG - Intronic
1134406953 16:13969413-13969435 TCCAGAGATGCCAGGAGCCAAGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135477865 16:22793597-22793619 TGCTGAGATGTCTGGAGAAAGGG + Intergenic
1137701676 16:50502257-50502279 GCCAGTGCTGTCTGCATACAGGG + Intergenic
1138330550 16:56211787-56211809 TCCAGAGCTGGCTGCATACAAGG + Intronic
1140300448 16:73752407-73752429 TCCAGAGTTTCCTTCAGACATGG + Intergenic
1141098238 16:81178101-81178123 TCCAGAGATGTCTGAAGTTCTGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141952926 16:87350605-87350627 TCCACAGATGGCTGCAGGGATGG + Intronic
1141982358 16:87558459-87558481 TCCAGAGGGGTGTGCAGAAATGG + Intergenic
1143393059 17:6571532-6571554 TGTAGAGAGGTCTGCAGGCATGG - Intergenic
1145971944 17:28961278-28961300 TCTAGAGAAGTCAGCAGAGAGGG - Intronic
1146737202 17:35248681-35248703 TCTACAGATGTCTGCATACCTGG - Intronic
1147038147 17:37697315-37697337 TCCTGAAATGTCTGGGGACATGG + Intronic
1147484775 17:40802073-40802095 TGCAGAGAGGTCTGCAGAAAAGG + Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148109509 17:45136733-45136755 TTCAGTGATGTAGGCAGACATGG - Exonic
1148840376 17:50492057-50492079 TCCAGAGATGCCTGGAGGAATGG - Intergenic
1148914892 17:50968148-50968170 TCCAGGGATGTCAGCAGGAATGG - Intronic
1149386751 17:56150118-56150140 TGCATAGGTGTCTGCAGGCAGGG - Intronic
1149869809 17:60171287-60171309 TGCAGAGAGCTCTGCAAACAAGG + Intergenic
1151971227 17:77458421-77458443 CTCAGCGAGGTCTGCAGACAGGG + Intronic
1152245317 17:79182344-79182366 CCCAGAGATGTGGGCAGCCAGGG + Intronic
1152798348 17:82319534-82319556 TCCACACATGTATGCAGAGACGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159069910 18:63612077-63612099 CCTAGAGATGACTGCAGACCTGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161581136 19:5081683-5081705 TCCAGAAATATCTGCACACCGGG - Intronic
1162160767 19:8713529-8713551 GCCAGAGATGGCTGGAGGCACGG - Intergenic
1162368036 19:10261238-10261260 TCCAGAGAGGTTTTCAGCCAGGG - Intergenic
1163005461 19:14394426-14394448 CCCTGAGATGCCTGGAGACAGGG - Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163476879 19:17531821-17531843 TCCAGAGATGTCTGGAGGCCAGG - Intronic
1164617348 19:29674984-29675006 TCCCTAGATGTCTGGAGACCTGG - Exonic
1166066837 19:40365080-40365102 TCAAGAGATAACTGCAGAAAAGG - Intronic
1168137267 19:54360062-54360084 TCCAGAGCTTTCTGTAAACAGGG + Exonic
1168160810 19:54509023-54509045 TCCAGAGCTTTCTGTAAACAGGG - Exonic
925921348 2:8639904-8639926 TCCTTAGCTGTGTGCAGACATGG - Intergenic
926232953 2:11018741-11018763 TCCAGGGATGCCTGCAGGCAGGG - Intergenic
927195632 2:20544583-20544605 GCCAGAGCTGACTGCAGCCAGGG + Intergenic
928395902 2:30943232-30943254 TCCAGAGAAGTCTGGGGACTGGG - Intronic
929581450 2:43084008-43084030 TCCAGAAATGTTTGCAGGGAGGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
932450688 2:71808723-71808745 CCCTGAGATGTCTGCGGACTAGG + Intergenic
933882681 2:86686539-86686561 TCCAGTGATTTTTGAAGACAAGG + Intronic
934520580 2:95017897-95017919 CCCAGAGTTGGCTGCACACAGGG - Intergenic
934855813 2:97729075-97729097 TCCAAAGAGGTCTGCAGTCCAGG - Intronic
935938682 2:108215851-108215873 TCCAGTGCTCTCTGCTGACAAGG - Intergenic
937473872 2:122196920-122196942 TCCAGAAATGTCTGCTGAATGGG + Intergenic
938255358 2:129855168-129855190 ACCAGGGATGTGTGCACACAAGG - Intergenic
939629277 2:144514917-144514939 GCCAGAGATGTCCGCAGTCATGG - Intronic
939952143 2:148488167-148488189 TGCAGAGAAGTCTGCTGCCAGGG + Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940188794 2:151016098-151016120 TCCAGACTTGTCTGAATACACGG + Intronic
942001467 2:171652502-171652524 TCCTGAGCTGTCTGGAGCCAGGG + Intergenic
945012832 2:205482919-205482941 TCCAGAGAAGTCTGAAGAAAGGG - Intronic
946449402 2:219766793-219766815 GTCAGAGATGTCTGCCCACAAGG - Intergenic
947585911 2:231356817-231356839 TCCAGAGATTTCTGCTGCCAGGG + Intronic
948568976 2:238905425-238905447 CCCAGCCATGTCTGCTGACATGG - Intronic
948750875 2:240132191-240132213 TCCAGACAAGTCAGCAGGCAGGG - Intronic
949021813 2:241744997-241745019 AGCAGAGATGTCAGGAGACACGG - Intronic
1170704992 20:18737189-18737211 CACAGAGATGACTGAAGACAAGG - Intronic
1171147975 20:22802474-22802496 TGCAGGGATGTCCGCACACAAGG + Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1175244289 20:57572299-57572321 TCCAGAGATTTCTGCTGCTAGGG - Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175882082 20:62265587-62265609 TCCAGTGCTGTCTGCTGAGAGGG - Intronic
1176308367 21:5136201-5136223 TGCAGAGCTAGCTGCAGACAGGG + Intronic
1177280912 21:18982178-18982200 TCCAGGGGTGTCTGAAAACAAGG + Intergenic
1177367043 21:20152348-20152370 TCCAGATCTCTCTGCTGACAGGG + Intergenic
1179194560 21:39153066-39153088 TGGAGAGATTTCTGCAGTCAGGG - Intergenic
1179848693 21:44125831-44125853 TGCAGAGCTAGCTGCAGACAGGG - Intronic
1179920990 21:44507248-44507270 TCCAGAGTTGTCTGCAGCCATGG + Intronic
1179920993 21:44507265-44507287 TCCACAGATATGTGCAGCCATGG - Intronic
1180841081 22:18959243-18959265 TCCAGAGATGTCTGGGGGCCAGG + Intergenic
1181060416 22:20279550-20279572 TCCAGAGATGTCTGGGGGCCAGG - Intronic
1181085078 22:20436215-20436237 TCCTGGGAGGTCTGCAGACCAGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183831529 22:40420707-40420729 TACAGAGTGGTCTGCAGGCAGGG - Intronic
949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG + Intronic
950633972 3:14302354-14302376 TCCACAGAGGTGAGCAGACAGGG + Intergenic
951589958 3:24253891-24253913 TCCAGAAACGTTTGAAGACATGG - Intronic
951742610 3:25940927-25940949 TCCAGTGATGTCTTTAGAAAAGG + Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953462777 3:43094948-43094970 GCCAGATCTGACTGCAGACAGGG - Intronic
953808866 3:46094992-46095014 TTCAGAGCTGCCTGCAGGCATGG + Intergenic
955504010 3:59613260-59613282 CCTAGAGATTTCTGCAGAGAAGG + Intergenic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
957095207 3:75771778-75771800 TCCAGCCATGACTGCAGACCCGG + Intronic
958519612 3:95168178-95168200 ACCAGATATGTATGCACACAGGG + Intergenic
961006222 3:123407017-123407039 TCCAAAGATGTCTGCAGGTCTGG - Intronic
961392194 3:126558748-126558770 TCCAGAGAGGGCTGTAGCCAGGG - Exonic
962461494 3:135618522-135618544 TCCTGAGATGTGGGCAGAAAGGG - Intergenic
963548893 3:146696451-146696473 AGCAGAGATTTCTGCACACAGGG - Intergenic
964132911 3:153311213-153311235 CCCTGAGATGGCTGCAGACCTGG + Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
965489107 3:169315132-169315154 TCCAGATATGCCTGCAGAATAGG + Intronic
965960370 3:174422324-174422346 TCCAGAAATGTCTACCAACAAGG - Intergenic
967292926 3:187938992-187939014 TCCAAAGAGGTGTGCAGACTGGG - Intergenic
967761369 3:193229595-193229617 TGCACAGATATCTGTAGACATGG + Intergenic
968764615 4:2461823-2461845 TCCACAGGTACCTGCAGACATGG - Intronic
968858756 4:3149726-3149748 TCCAGAGATGTTTGCAGAGAAGG - Intronic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969287038 4:6209273-6209295 ACCAGAGATGTCTGAATAAAGGG + Intergenic
969304616 4:6318566-6318588 TCCAGCGGGGTCTGCACACATGG - Intergenic
972897425 4:43640663-43640685 TGCAGAGATGGTTGCAGATATGG + Intergenic
973008040 4:45037532-45037554 TTCAGTGATGTTAGCAGACACGG + Intergenic
975529337 4:75384959-75384981 CCCAGAGAGATCTGCAAACATGG + Intergenic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976349289 4:84042672-84042694 TCCAGCGCTGTCTAGAGACATGG - Intergenic
977281606 4:95046980-95047002 TACAGAGTTGACTGCAGAGAAGG - Intronic
977935314 4:102795733-102795755 TCCACATGTGTGTGCAGACAAGG + Intronic
981422731 4:144570134-144570156 TCCAGAGAGGTCTACAGAAGTGG + Intergenic
981432370 4:144676611-144676633 CCCAGAGATGGCTCCAGAGATGG - Intronic
981726622 4:147854286-147854308 TCCAGAGAAATCAGAAGACATGG + Intronic
983790523 4:171792063-171792085 TCCAATGATGTCTCCAGAAAAGG - Intergenic
986778928 5:11046259-11046281 TCCAGAGATAGATGCACACAAGG + Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987371704 5:17199549-17199571 TCCAGACGTGTTTCCAGACAAGG + Intronic
987531845 5:19130946-19130968 TCCAGAGCTGTGTGCAGCCTAGG - Intergenic
989299777 5:39877188-39877210 ACATGAGATGTCTTCAGACATGG - Intergenic
989780173 5:45255306-45255328 TCCAGAAATGTCTTCACACTTGG + Intergenic
990613449 5:57482791-57482813 TCCAGAAATGCTTTCAGACACGG + Exonic
994471198 5:100210335-100210357 TCCAGAGATTTCTGTAGAATTGG + Intergenic
997638745 5:135434820-135434842 TCCAGAGATTCCTGCAGGCTCGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
1000475694 5:161704215-161704237 TCCTGAGATTTCAGCAGCCATGG - Intergenic
1001072670 5:168600476-168600498 TCCAGTGATTTCAGCAGACTGGG + Intergenic
1001237236 5:170040516-170040538 CCCAGAGAACTCTGCAGAGAGGG + Intronic
1001708917 5:173762363-173762385 TCCAGGAATGGCTGCAGATAAGG + Intergenic
1001878567 5:175222513-175222535 TCCAACCATGTCAGCAGACAGGG - Intergenic
1005132482 6:22525065-22525087 TCCTGAGATGTCTCCAGGGAGGG + Intergenic
1005946807 6:30601623-30601645 TCATGAAATGTCGGCAGACAGGG + Exonic
1006802493 6:36768074-36768096 TCCAGGGATGGCTGCAGCCTGGG + Intronic
1006990720 6:38212616-38212638 TCCAGAGATGCCTGCTGGCAAGG - Intronic
1007483219 6:42163509-42163531 TCCAGAGGTTTCTGAAGACTTGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009292020 6:61894312-61894334 TCCAGAAATCTCTGAATACATGG + Intronic
1010366623 6:75058988-75059010 TCCAGAGAAGTCTGCTGCCAGGG - Intergenic
1011107346 6:83797486-83797508 TGGATAGATGTCTTCAGACAAGG - Intergenic
1012244100 6:96906914-96906936 TCCAGAGAAGTCTCCAGAGAAGG + Intergenic
1012310246 6:97714988-97715010 ACCAGAGCTGTGTGCACACAGGG - Intergenic
1014773540 6:125483766-125483788 TCCAGAGATGTTGTCAGGCAGGG - Intergenic
1015480193 6:133700255-133700277 TCAAGAGAGGTCTGCACACTGGG + Intergenic
1017797675 6:157861691-157861713 TCCAGGGATGCCTGCAACCAAGG + Intronic
1019610955 7:1936451-1936473 TCCACAGCTGCCTGCAGACTCGG + Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1022982489 7:35617608-35617630 TCTAGGGATGTCTGCAGGCAAGG + Intergenic
1024969392 7:55054568-55054590 TCCAGACAGGTCAGCAAACATGG + Intronic
1025090328 7:56057544-56057566 TACAGAAAAGTCTGCAGAGATGG - Intronic
1026959985 7:74401600-74401622 TCCAGAGAGGTCTGCCTGCACGG - Intronic
1028716194 7:93972561-93972583 GCCAGAGATGTAAGCAGAAATGG - Intronic
1028759144 7:94475552-94475574 GGCAGGAATGTCTGCAGACAAGG + Intergenic
1029168132 7:98610486-98610508 TCCAGATCTGTCTCCAGATATGG + Intergenic
1030912242 7:115264894-115264916 TCCAGAGTTGTCTGTAGTCTTGG + Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032108577 7:129055465-129055487 TCCAAAGATGACTTAAGACATGG + Intergenic
1033518319 7:142131718-142131740 TCCAGAGATTCCTGCAGAGAGGG - Intronic
1036597833 8:10230157-10230179 TTCAGAGTTCTCTGCAGAGAGGG + Intronic
1037520723 8:19678263-19678285 TCCAGACATCTCTGCATAGAGGG + Intronic
1038620410 8:29137429-29137451 CCCAGGAATGTCTGCAGGCACGG + Intronic
1039891805 8:41690561-41690583 CCCAGAGAGTTCTGCAAACAGGG + Exonic
1045754605 8:105528024-105528046 TCCAGAGGTTTCTGCAGAAGGGG + Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1052607186 9:30720033-30720055 TCCAGAGATGAAAGCAGCCATGG + Intergenic
1052838760 9:33272887-33272909 TCCACAAATGTTTGCATACATGG + Intronic
1052965177 9:34335106-34335128 TACAGAGCTGACTGCACACATGG - Intronic
1053353701 9:37429768-37429790 TCCAGAGATTTCTGTACACAGGG + Exonic
1053416428 9:37949714-37949736 CTCAGGGATGTGTGCAGACATGG + Intronic
1054731126 9:68704291-68704313 GCCAGAGATCTCTGAAGATAAGG + Intergenic
1054907427 9:70423082-70423104 CTCTGAGATGTCTGCATACAAGG - Intergenic
1055123530 9:72691765-72691787 TCCTGAGAAGTCTGAACACAGGG + Intronic
1055152967 9:73025208-73025230 TCCACAGTTGGCTGGAGACAGGG - Intronic
1055445403 9:76377416-76377438 TCCAGTCATATCTGCAGACCTGG + Intergenic
1055467751 9:76582373-76582395 TCCTGAGATGGCTGCAGTGAAGG + Intergenic
1055971588 9:81917470-81917492 TCCAGAGACATCTTCAGACGAGG + Intergenic
1055980124 9:81992834-81992856 TCCGGAGACTTCTTCAGACAAGG + Exonic
1057195345 9:93113314-93113336 TTCAGAGATGACTGCAGCTATGG + Intergenic
1059983022 9:119794065-119794087 TCCAGAATTGTATGCAGATATGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060216456 9:121741365-121741387 CCCAGAGAGGTCTGGAGGCAGGG + Intronic
1060891843 9:127193975-127193997 TCCAGACATGGCTGAAGACATGG + Intronic
1062012138 9:134272986-134273008 TCTACAGATGCCTGCACACAGGG - Intergenic
1062032218 9:134366799-134366821 TCCACAGATGCCTGGGGACAAGG + Intronic
1062338605 9:136083547-136083569 TCCAGAGGTGTCTTCTGAGAAGG + Intronic
1186705354 X:12134823-12134845 TCCACAGCTGTCTGCAGCCTTGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188040596 X:25366675-25366697 TCTAGAAATGTCTGAAGTCAGGG + Intergenic
1189064802 X:37795982-37796004 TCCAGTGATGCCTGCCAACAGGG - Exonic
1189121980 X:38404802-38404824 TCAAGAGATTTCTGGGGACATGG + Intronic
1190889828 X:54558363-54558385 TCCAAAGACTTCTGCAGAAAAGG - Intronic
1190935265 X:54993992-54994014 TCCTAAGATGTCTCCAGAGATGG - Exonic
1192214274 X:69147505-69147527 TCCTGAGATTTCAGAAGACAAGG + Intergenic
1194819674 X:98490291-98490313 TCCAGAGAGTTCTACAGAGATGG + Intergenic
1194894996 X:99429822-99429844 TCCAGAGTTCTCTGCTGAGAAGG - Intergenic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198772734 X:140148254-140148276 TCCTGGGATCTCTGAAGACAAGG - Intergenic
1198963921 X:142208060-142208082 TCCAGAGCTGGCAGCAGGCATGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201727038 Y:17165257-17165279 TCAAGAGATGTCTTGAGACTTGG + Intergenic
1202075093 Y:21029516-21029538 GCAAGAAATGTGTGCAGACAAGG - Intergenic