ID: 1076805876

View in Genome Browser
Species Human (GRCh38)
Location 10:132858494-132858516
Sequence GCTGCCAGCCACTCCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 2, 3: 63, 4: 420}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076805876_1076805883 5 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805883 10:132858522-132858544 TGGTGGGGACGGCTGGCATCAGG No data
1076805876_1076805881 -6 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805881 10:132858511-132858533 GGCAGCTGCTGTGGTGGGGACGG No data
1076805876_1076805885 15 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805885 10:132858532-132858554 GGCTGGCATCAGGGCTGTGCTGG No data
1076805876_1076805886 27 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805886 10:132858544-132858566 GGCTGTGCTGGCCCTGCCCTCGG No data
1076805876_1076805887 30 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805887 10:132858547-132858569 TGTGCTGGCCCTGCCCTCGGTGG No data
1076805876_1076805884 6 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805884 10:132858523-132858545 GGTGGGGACGGCTGGCATCAGGG No data
1076805876_1076805880 -10 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805880 10:132858507-132858529 GGCTGGCAGCTGCTGTGGTGGGG No data
1076805876_1076805882 -2 Left 1076805876 10:132858494-132858516 CCAGGGTGGGAGTGGCTGGCAGC 0: 1
1: 1
2: 2
3: 63
4: 420
Right 1076805882 10:132858515-132858537 GCTGCTGTGGTGGGGACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076805876 Original CRISPR GCTGCCAGCCACTCCCACCC TGG (reversed) Intronic
900096897 1:943418-943440 GCTGGCAGTCACTACCTCCCTGG + Intronic
900126685 1:1071871-1071893 GCTGCCTGCCCCTGCCCCCCCGG - Exonic
900154975 1:1200301-1200323 GCTGCCCCCCACTCGGACCCAGG + Intergenic
900319034 1:2073443-2073465 GCTGTCCCCCACTCCCAGCCTGG + Intronic
900485824 1:2922212-2922234 GCTGGCAGCCACTCACCACCAGG - Intergenic
900546654 1:3233197-3233219 GCCACCGGCCACCCCCACCCTGG - Intronic
900554979 1:3275820-3275842 GGTGCCACCCACTTCCACGCTGG - Intronic
900640680 1:3686742-3686764 GCCCCCAGCCACACCCACCTCGG - Intronic
900762791 1:4484036-4484058 TCTGCATGCCACTTCCACCCAGG + Intergenic
900791087 1:4681397-4681419 GCTGCCAGCCACACCCACCCTGG + Intronic
901035114 1:6331788-6331810 GCAGCCAGCCACACCCACCTGGG + Intronic
901207211 1:7504027-7504049 GCTGCCACCCTCTCCTGCCCGGG - Intronic
902241728 1:15094456-15094478 CCTGCCCCCCACTCCTACCCTGG + Intronic
902265233 1:15258659-15258681 ACTGCCAACCTCTGCCACCCGGG + Intronic
902301062 1:15503009-15503031 CCTGCCCCCCGCTCCCACCCCGG - Intronic
902383314 1:16062608-16062630 GCTGACCCCCACCCCCACCCAGG - Intronic
902392668 1:16115497-16115519 GGTGCCAGCCACTACCTTCCAGG + Intergenic
902531083 1:17091147-17091169 GCTGCTGGCCACTGCCATCCTGG + Intronic
902796525 1:18804098-18804120 GCTGCCTGCCGCCCCCAGCCTGG + Intergenic
902829004 1:18997612-18997634 GCTGCCAGCCCAACCCAGCCCGG + Intergenic
903012650 1:20342517-20342539 GCTGCCAGCCCTTCCTGCCCTGG + Exonic
903295669 1:22341877-22341899 ACTGCCAGCCACTTCCCGCCGGG - Intergenic
903596984 1:24502726-24502748 GCGGCGAGACACCCCCACCCCGG + Intronic
904829831 1:33299550-33299572 GCTTCCTGCCCCTCCCACCTGGG - Exonic
904840618 1:33369766-33369788 GCTGCATGCTACTGCCACCCAGG + Intronic
904941401 1:34166620-34166642 GTCGCCAGCCACCCCCAGCCTGG - Intergenic
904978311 1:34475734-34475756 GCTGCCAGCCTCTTCCTCCAGGG - Intergenic
905409328 1:37757415-37757437 ACTGCCAGCCACTCTAACCATGG + Intronic
905917740 1:41697551-41697573 CCTGCCAGCCAGTCCCACCTTGG - Intronic
906242191 1:44248908-44248930 GCTGCCAGCAACCTCCACCTGGG + Intronic
906416231 1:45622894-45622916 CCAGCCCGCCCCTCCCACCCCGG + Intronic
906478667 1:46186355-46186377 GCTGCCTGCCTTTCCCACTCAGG + Intergenic
910492373 1:87786685-87786707 GTCTCCAGCCATTCCCACCCTGG - Intergenic
911178278 1:94839462-94839484 ACTGCCAACCTCTGCCACCCGGG + Intronic
912489591 1:110054747-110054769 GCTGCCTGCCTTTCCCATCCTGG + Intronic
913236004 1:116784096-116784118 GCTCCCAACCAGTCACACCCAGG - Intergenic
913329187 1:117653177-117653199 GCTGCCAACCGCTCCTCCCCTGG - Intergenic
914061046 1:144208237-144208259 CCTCCCAGCCACCCCCACCCAGG - Intergenic
914118104 1:144758132-144758154 CCTCCCAGCCACCCCCACCCAGG + Intergenic
915289996 1:154877187-154877209 CCTGCCCACCACTCCCACCCAGG + Intergenic
915310830 1:155005104-155005126 GCTGCCCGCCGCACCCTCCCTGG - Intronic
915526594 1:156479951-156479973 CCTGCCTGCCAGTCCCACCAAGG + Intronic
915898140 1:159827126-159827148 GCTGCCACCTCCTCCCTCCCAGG - Intronic
916412420 1:164559322-164559344 GCTGCCCCCCACCCCCACTCCGG - Intronic
916479383 1:165201487-165201509 GCTGCCTGGCTCTCCCATCCTGG + Intergenic
917585877 1:176425958-176425980 GCCTCCAGCCACTCCCAGGCAGG - Intergenic
917968653 1:180193940-180193962 GGTGCCTGTCACTCACACCCAGG - Intronic
919807018 1:201386262-201386284 ACTGCCGGCCAGTCCCACCCAGG - Intronic
919830771 1:201538993-201539015 GCCGCCAGGCACTCCCCTCCTGG + Intergenic
920033100 1:203048991-203049013 GCGGCCAGCCCCGCCCAGCCTGG + Intronic
920535249 1:206732883-206732905 CCTCCCAGCCTCTCCCACTCTGG - Exonic
922561407 1:226572437-226572459 GCTGTTAGCCTCTCCCACCTCGG - Intronic
922565999 1:226602223-226602245 GCTGCCAGCCCCTCCTGCTCTGG + Exonic
922720406 1:227897216-227897238 GCTGCCAGCCCCTCACATACAGG + Intergenic
922895791 1:229099119-229099141 GCTGCCAGGGACTCACACACTGG + Intergenic
923436885 1:233975681-233975703 GCTCCCAGCCACTTCCTCACTGG - Intronic
1063137124 10:3227592-3227614 TGGGCCAGCGACTCCCACCCTGG - Intergenic
1063486128 10:6422897-6422919 GTTGGCAGCAACTCCCACCAGGG - Intergenic
1064158717 10:12925165-12925187 GATGCCAGCCAGTCTGACCCAGG - Intronic
1065244249 10:23741656-23741678 GCTGCCAGCCACTCCCAGGATGG + Intronic
1065594664 10:27298646-27298668 CCAGACAGCCACACCCACCCCGG - Intergenic
1066114296 10:32226096-32226118 GTCACCAGCCACGCCCACCCTGG + Intergenic
1067063843 10:43092673-43092695 GCTGCCAGCCAGACTCACTCGGG - Intronic
1067135853 10:43606640-43606662 GCCGCCTTCCCCTCCCACCCCGG - Intronic
1067216873 10:44310822-44310844 CCTGCCTGCCTCTCCCACGCTGG - Intergenic
1067479879 10:46587753-46587775 GCTGCCAGCCAGCCCGAGCCAGG + Intronic
1067578755 10:47425928-47425950 GCCTCCAGCCACCCCCACCAGGG + Intergenic
1067614858 10:47754044-47754066 GCTGCCAGCCAGCCCGAGCCAGG - Intergenic
1067741174 10:48897084-48897106 GCTGGCCCCCACTCTCACCCAGG + Intronic
1069704725 10:70451198-70451220 GGTGCCCTCCCCTCCCACCCCGG + Intergenic
1070287180 10:75092653-75092675 CCTGCCTGCCACACTCACCCAGG - Intergenic
1070327905 10:75400015-75400037 CCTGCCAGCCATTCACGCCCAGG - Exonic
1070865224 10:79704511-79704533 GCCCCCAGCCTCGCCCACCCAGG - Intronic
1070879015 10:79842642-79842664 GCCCCCAGCCTCGCCCACCCAGG - Intronic
1071632122 10:87226732-87226754 GCCCCCAGCCTCGCCCACCCAGG - Intronic
1071645575 10:87358951-87358973 GCCCCCAGCCTCGCCCACCCAGG - Intronic
1072512579 10:96142880-96142902 ACTGCCAACCTCTGCCACCCGGG + Intronic
1073012286 10:100370860-100370882 GCTCCCTGCCACTGCCACCCAGG - Intergenic
1074531659 10:114302533-114302555 GGTGCCAGCCCCTCCCCACCAGG + Intronic
1074778809 10:116785734-116785756 GCTGTCACCCCCTCCCTCCCAGG + Intergenic
1076337517 10:129718409-129718431 GCTGCCCCCCACCCCCACCCTGG + Intronic
1076439589 10:130471961-130471983 TCTGCCAGCCACCCCCATCTGGG + Intergenic
1076630617 10:131849850-131849872 CCTGCCTGCCACCCCCACCAGGG - Intergenic
1076805876 10:132858494-132858516 GCTGCCAGCCACTCCCACCCTGG - Intronic
1077056895 11:598180-598202 GCTGCCAAGCACTCCCACGGGGG - Intronic
1077106575 11:844893-844915 GCTGCTGACCCCTCCCACCCTGG + Intronic
1077150566 11:1071282-1071304 GGTGCCAGCCCCCACCACCCTGG + Intergenic
1077185415 11:1233529-1233551 GGTGGCCCCCACTCCCACCCTGG + Intronic
1077227049 11:1443044-1443066 GCTGCCAGGCCCTCCCCCCAGGG - Intronic
1079365705 11:19807534-19807556 GCTGCAGGCCAATCCCAGCCTGG + Intronic
1079409612 11:20174953-20174975 GCTGCCCCCCACCCCCACCCGGG - Intergenic
1079472331 11:20790160-20790182 GGAGCCAGCCACTTCCACCCAGG + Intronic
1079493231 11:21012432-21012454 GATGCCAGCCACTCCCATGCAGG - Intronic
1083849211 11:65355392-65355414 GCCGCCTCCCACTCCCTCCCGGG + Intronic
1084039281 11:66532008-66532030 GCCGCCAGCCCCTCGCTCCCAGG - Exonic
1084724076 11:70928916-70928938 TCTGCCAGCCCCACCCTCCCAGG - Intronic
1084891610 11:72239669-72239691 CCTGACAGCCCCTCCCATCCTGG - Exonic
1085041151 11:73327106-73327128 GCAGGCAGCACCTCCCACCCGGG + Intronic
1085296479 11:75434470-75434492 GCTCCCAGCCACTGGCACCATGG + Intergenic
1085319494 11:75565241-75565263 TCTGACAGCCACTGCCACACAGG - Intronic
1087869401 11:103273429-103273451 TCTGCCCGCCTCTCCCTCCCAGG + Intronic
1088834554 11:113566958-113566980 GCTTCCAGCCACTCCCAGCATGG + Intergenic
1090224746 11:125063285-125063307 GCTGACAGCCAGTCCAGCCCGGG + Intronic
1091290532 11:134437019-134437041 GCTGCAAGCTACAGCCACCCTGG - Intergenic
1091353400 11:134915448-134915470 GCTGCCAGCCACTTCCCTGCTGG + Intergenic
1091382926 12:74468-74490 TCTGCCCTCCACCCCCACCCGGG - Intronic
1091849229 12:3681645-3681667 GCTGTCAGTCACTTCCACACTGG - Intronic
1092123209 12:6058604-6058626 GCTGCCTGCCACTCAGGCCCTGG + Intronic
1094524312 12:31221612-31221634 GATGCAAGCCACCCTCACCCTGG - Intergenic
1097363237 12:58680802-58680824 GCTCCCAGCCACTCCCTGTCAGG + Intronic
1097992226 12:65848064-65848086 GCTGCTAGCCACTATCACCCAGG + Intronic
1098541488 12:71663136-71663158 GACTCCAGCGACTCCCACCCCGG + Exonic
1100433924 12:94554442-94554464 GCTACCAGCCCCTCCCACCATGG - Intergenic
1102031381 12:109741894-109741916 GCACCCAGCCACTCCCTGCCTGG + Intronic
1103721828 12:122979359-122979381 CCTGCCTGCCACCCCCACACTGG - Exonic
1103997228 12:124838285-124838307 TCAGTCAGCCCCTCCCACCCCGG + Intronic
1104977617 12:132559307-132559329 GCTGCAAGCCCCGCCCTCCCTGG - Intronic
1105292584 13:19062204-19062226 CCAGCCAGCCACTGCCACACTGG - Intergenic
1105344590 13:19561113-19561135 GCTCCCACCCACTGCCTCCCAGG - Intergenic
1105535448 13:21260460-21260482 GCTCCCACCCACTGCCTCCCAGG + Intergenic
1106201263 13:27539144-27539166 ACTGCTAGCCTCTCCCACCAGGG - Intergenic
1106413101 13:29524627-29524649 GCCGCCAGCCAGTCCTACCCCGG + Intronic
1106413335 13:29525944-29525966 CCGGCCACCCACTCCCACCCTGG + Intronic
1107455164 13:40548230-40548252 GCTTCCAGCCAGTCCTATCCAGG + Intergenic
1109808227 13:67471577-67471599 GCTCCCAGCCAATCCCAGCTAGG + Intergenic
1111354572 13:87080738-87080760 CCGGCCAGCCTCTCCCACCGCGG + Intergenic
1111507751 13:89216066-89216088 ACTGCCAGCCTCTGCCTCCCGGG - Intergenic
1112630025 13:101150239-101150261 GCTCCCCGCCACCCCCACCCAGG - Intronic
1114417925 14:22556642-22556664 GCCGGCAGCCCCTCCCAGCCTGG - Exonic
1115641861 14:35340294-35340316 GCTGCCTCCCACCACCACCCGGG + Intergenic
1117183569 14:53217490-53217512 GCTGCCTGCCAGTCCCGCGCAGG + Intergenic
1117353341 14:54902019-54902041 GCTCCCGTCCACGCCCACCCGGG + Intronic
1117803974 14:59470933-59470955 GCCCCCAGCCACCCCCACACTGG - Intronic
1119804729 14:77475365-77475387 GCTCCCAGGGACACCCACCCTGG + Exonic
1120886298 14:89454322-89454344 GCAGACAGCCACAGCCACCCTGG - Intronic
1122663394 14:103312467-103312489 GCTGGCAGCCCCTGACACCCTGG + Intergenic
1122922583 14:104886100-104886122 GCTGACAGCTACTCAGACCCGGG + Exonic
1124207303 15:27732471-27732493 GCTGGCAGCCCCTACCATCCTGG - Intergenic
1124218000 15:27825477-27825499 TCTCCCCGCCACTCCCAGCCGGG - Intronic
1125726355 15:41870211-41870233 GCTGGCTGCCTCTCCGACCCAGG - Intronic
1126247490 15:46526483-46526505 GCTGCCAGACACTCCCAGGAGGG + Intergenic
1127483630 15:59399814-59399836 GTGGCCAGCCACTCCCTCCAGGG + Intronic
1128513533 15:68327888-68327910 GCTCACTGCCACTCTCACCCTGG + Intronic
1128697383 15:69778416-69778438 GCTGCAAGCCCCTCCAACCCAGG - Intergenic
1130546226 15:84858994-84859016 GCTGGGAGCCCCTCCCAGCCTGG + Intronic
1130560473 15:84954255-84954277 GCTGCCAGCTTCTACCTCCCTGG - Intergenic
1131180191 15:90234028-90234050 GCTGCCAGGCGTTCCCAGCCGGG + Exonic
1132130690 15:99275700-99275722 GTTGCCGGCCACTCCCAGCAAGG - Intronic
1132275400 15:100559117-100559139 GCCGGCAGCTGCTCCCACCCGGG - Intergenic
1132571472 16:646251-646273 CCTGCAACCCACTCCCACCTCGG - Intronic
1132731140 16:1362557-1362579 GCTCCCAGCCAGGCCCACCAGGG - Intronic
1132841604 16:1980802-1980824 GCTCCCAGCCCCTGCCATCCGGG - Exonic
1132854265 16:2037822-2037844 GCTTCCAGGCACTGCCATCCTGG - Exonic
1132942485 16:2514844-2514866 ACTTCCACACACTCCCACCCGGG - Intronic
1132959229 16:2612883-2612905 CCTGCGAGCCACTCCCACAGGGG - Intergenic
1132972289 16:2694858-2694880 CCTGCGAGCCACTCCCACAGGGG - Intronic
1133022881 16:2974589-2974611 GCTGCCAGCCCTCCCCACCGTGG + Exonic
1133115447 16:3575843-3575865 GCTGCCAGTATCTCCCACCACGG + Intronic
1134065258 16:11224332-11224354 GCTCCCAGCCCCTCCCGCCCAGG - Intergenic
1134194681 16:12150215-12150237 ACTTCCAGCCCCTCCGACCCTGG - Intronic
1135220543 16:20611143-20611165 GCAGCCAGCCTCTCTCAGCCAGG - Intronic
1135566692 16:23516681-23516703 GGTGCCTGCCACTCCCCACCTGG + Intronic
1136394837 16:29987209-29987231 CCTGCAGGCCACCCCCACCCTGG - Exonic
1136773035 16:32857900-32857922 GCTGCCACCCACTCGCAGCGAGG - Intergenic
1136897580 16:34003619-34003641 GCTGCCACCCACTCGCAGCGAGG + Intergenic
1137830542 16:51539358-51539380 GCTTCCCCTCACTCCCACCCTGG - Intergenic
1139468844 16:67167629-67167651 GCTGCCAGGCCCTCCCCCACAGG - Intronic
1140528893 16:75647598-75647620 GCTGCCATCCACTTTCACCTCGG + Exonic
1140598729 16:76448777-76448799 ACTGCCTTCCACTTCCACCCTGG + Exonic
1141551934 16:84812083-84812105 GCAGCCACCAACTGCCACCCTGG + Intergenic
1142116451 16:88358524-88358546 CCAGCCTGCCACTCCCACCCAGG + Intergenic
1203075460 16_KI270728v1_random:1120010-1120032 GCTGCCACCCACTCGCAGCGAGG - Intergenic
1142811098 17:2395847-2395869 TCTGCCCGCCTCTCCCACCTCGG - Intronic
1143110016 17:4547926-4547948 GCTCACAGCCCCTCCCTCCCAGG + Intronic
1143366887 17:6414334-6414356 TCTGCCAGCCCCTCCCACACTGG - Intronic
1143788183 17:9272356-9272378 CCTACCAGCCACTCCCTGCCGGG - Intronic
1143965110 17:10751437-10751459 GCTGCCAGTCCCTCCCCTCCAGG - Intergenic
1144775997 17:17784900-17784922 GCAGCCCCCCAGTCCCACCCAGG + Intronic
1145263112 17:21366332-21366354 GGGGCCAGCCCCTCCCAGCCAGG - Intergenic
1146465683 17:33084380-33084402 CCTGCCAGCCAGTCCCTCCCTGG + Intronic
1147141844 17:38464770-38464792 GCTGCCAGCCCACCCCAGCCTGG - Intronic
1147742973 17:42679248-42679270 GCAGCCCCCCACCCCCACCCAGG + Exonic
1147754934 17:42761664-42761686 GGTGCCAGCCCCTCCCTCCCCGG + Intronic
1148347798 17:46915236-46915258 TCTTCCAGCCATTCCCACCAAGG - Intergenic
1148855350 17:50576102-50576124 GCTGCCAGGCGCCCCCTCCCAGG + Exonic
1150292325 17:63988863-63988885 GCCGCCAGCACCCCCCACCCCGG + Intergenic
1150587407 17:66531405-66531427 GATGCCACCGGCTCCCACCCCGG - Intronic
1151551727 17:74826300-74826322 GCTGCCACCTCCTGCCACCCTGG + Intronic
1152007776 17:77693382-77693404 GCTGCCAGTCCCACCCCCCCTGG + Intergenic
1152067821 17:78121238-78121260 GCTACCTGCCAGTTCCACCCCGG - Intronic
1152569839 17:81116838-81116860 GCCTACAGCCACTCACACCCCGG + Exonic
1152799482 17:82324173-82324195 CCTCCCTGCCACCCCCACCCCGG - Intronic
1154231166 18:12557421-12557443 GCTGCCAGCCACTCCAAATGTGG + Intronic
1155044176 18:22089063-22089085 CCTGCCAGGCACCCCCACACGGG - Intronic
1156742572 18:40350129-40350151 GGTTCCAGCCACCACCACCCTGG + Intergenic
1157500368 18:48186207-48186229 GCTGCCTCCCTCTCCCTCCCCGG + Intronic
1157682306 18:49616599-49616621 GCTGCCAGTCACTGCCTACCTGG + Intergenic
1160793354 19:933033-933055 GGCGCCAGCCTCTCCCTCCCAGG - Intronic
1160898050 19:1412055-1412077 CCTGCCAGCCCCGCCCTCCCAGG - Intronic
1160980789 19:1815743-1815765 CCTGCCAGGCCCTCCCTCCCGGG - Exonic
1161236843 19:3202397-3202419 GGTGCCACCCACTCCATCCCAGG + Intronic
1161332852 19:3696602-3696624 GCTGCCCCCCACCCCCACCCCGG - Intronic
1161773117 19:6242010-6242032 TCTGCAAGCAACTCCCTCCCTGG - Intronic
1162381379 19:10333731-10333753 GCTGCAAGTCTCTCCCACCCAGG - Intergenic
1162930717 19:13956241-13956263 GATGCCAGCCGAGCCCACCCAGG + Exonic
1163275930 19:16284124-16284146 GCTGCCAGCGCCCCCCAGCCTGG - Intergenic
1163391496 19:17033664-17033686 ACTGCCAACCTCTGCCACCCGGG + Intergenic
1163613272 19:18311789-18311811 CCTGACCGCCACCCCCACCCGGG - Intronic
1163652988 19:18529702-18529724 GCTGCCTGCCACAGCCACCCAGG - Intergenic
1163744099 19:19034520-19034542 TCTACCAGCCACACCCACTCTGG - Intronic
1165404306 19:35620305-35620327 GCCGCCAGGCCTTCCCACCCAGG + Exonic
1165466282 19:35976966-35976988 CCTGCCAACCACTAGCACCCTGG + Intergenic
1166305684 19:41935843-41935865 TCTGCCCGCCACCCCCTCCCAGG + Intergenic
1166337048 19:42114583-42114605 GTTTCTAGCCCCTCCCACCCCGG - Intronic
1166669452 19:44701250-44701272 GGTGCCCGCCACACCCACCCTGG + Intronic
1167321010 19:48797141-48797163 GGTGCCACCCACTTCCACCAGGG + Intronic
1167324129 19:48813505-48813527 GCTGCCAGCTCCTCCCACAGCGG + Exonic
1167437806 19:49490045-49490067 CCTGCCAGCCACTCTTCCCCAGG + Intronic
1167454811 19:49592465-49592487 GCTGCCAGCCACGCACGCACAGG - Intronic
1167455310 19:49594642-49594664 ACAGCGAGCCAGTCCCACCCTGG - Intronic
1167773506 19:51538680-51538702 GCTCCCAGCCAATCCCAGCCAGG + Intergenic
1168036146 19:53721273-53721295 GGTGCCACCCACTCCCGCCTGGG - Intergenic
1168354496 19:55692824-55692846 TCTCCCACTCACTCCCACCCGGG - Intronic
925346133 2:3173196-3173218 GCTGCCAGCCAAGCCGTCCCAGG + Intergenic
926213591 2:10889863-10889885 GCTGCCAGCCGTTCCCAGGCAGG + Intergenic
926315109 2:11703987-11704009 CCTTCCAGCCACCCCCACCAAGG - Intronic
926624602 2:15080705-15080727 GCTTCCAGCCACCCCCACCAGGG - Intergenic
927203217 2:20591222-20591244 GCTGCCAGCCCCTTCCTCCACGG + Intronic
927569330 2:24144648-24144670 GCTGCCAGCTGCTCACACCTCGG - Intronic
930007387 2:46909062-46909084 GCAGCCAGCTTCTCCCAACCCGG - Exonic
931215099 2:60234674-60234696 GGTGCCAGCCACTCTTAGCCAGG - Intergenic
931267746 2:60675434-60675456 GCTGCCCACCACTCCCGCCAAGG + Intergenic
932106124 2:68944265-68944287 CCTGCCTGCCAGTCCCTCCCAGG - Intergenic
932497667 2:72154490-72154512 GCTGCCAGCCACAGCCAGCTTGG - Intergenic
932714520 2:74091614-74091636 GCTGCCAGCCACTCTTGACCAGG - Intronic
933768975 2:85730820-85730842 GCTGCCGGACACTGCCACCTGGG - Intergenic
934715175 2:96538860-96538882 GCTGCCCGCCCCACTCACCCTGG - Intronic
934718250 2:96555397-96555419 GCTGGCAGCAACCCCCACCTCGG + Intergenic
935427380 2:102934271-102934293 GCTGGCAGCCACTTCCATCAGGG - Intergenic
936004175 2:108867304-108867326 GCTGCCAGTAATTCCCACTCTGG - Intronic
936471771 2:112805274-112805296 GCTGCCAGCTAGTCTCAGCCTGG + Intergenic
937978038 2:127593417-127593439 GCTGCCGCCCACCCCCGCCCAGG - Intronic
938199491 2:129361674-129361696 ACCCCCAGCCCCTCCCACCCAGG + Intergenic
939492979 2:142899060-142899082 CCTGCCATTGACTCCCACCCGGG - Intronic
941508355 2:166375840-166375862 GCTAGCAGCCACTGGCACCCAGG + Exonic
943876561 2:193073686-193073708 GCTCCCAGCCCATCCCACCCAGG + Intergenic
944630526 2:201619259-201619281 GCCTCCAGCCACTCCCAGCATGG - Intergenic
944848188 2:203690168-203690190 GCTGCCACCTGCTCCCACCTTGG + Intergenic
945803493 2:214462349-214462371 GCTTCTAGCCAGTCCCAGCCTGG + Intronic
946030069 2:216696504-216696526 TCTGCCACCCACTCCCTCCAGGG - Intergenic
946273640 2:218614523-218614545 ACTGCCAACCTCTGCCACCCAGG + Intronic
948702270 2:239767760-239767782 GCTCCCAGCCAGTCACTCCCAGG - Intronic
948939735 2:241189828-241189850 CCTGCCAGACGCTCCCGCCCCGG + Intronic
948991063 2:241554237-241554259 GCTGCTTGCCTCCCCCACCCTGG - Intergenic
949063340 2:241974221-241974243 ACGGCCAGCCCCACCCACCCAGG - Intergenic
1171151097 20:22827030-22827052 GCTACCATCCACTCCCACATTGG + Intergenic
1171971456 20:31567454-31567476 TTTGCCCTCCACTCCCACCCTGG + Intronic
1172083289 20:32358867-32358889 GCGGCGAGCCCCCCCCACCCCGG - Intronic
1172175126 20:32967568-32967590 ACACCCAGCCTCTCCCACCCAGG + Intergenic
1172580757 20:36045474-36045496 GGTGTTAGCCACTGCCACCCAGG - Intergenic
1173199871 20:40946410-40946432 GCTGCCAGCCCCCCTCACACTGG + Intergenic
1174017629 20:47501774-47501796 GGTTCCAGCGACCCCCACCCTGG - Intergenic
1174548402 20:51343651-51343673 ACTGCCATCCTCTCCCACCTGGG - Intergenic
1174794481 20:53510755-53510777 CCTGCCCTCCAGTCCCACCCTGG + Intergenic
1175249149 20:57598308-57598330 CCTGCCCCCCACGCCCACCCCGG - Intergenic
1175402479 20:58708392-58708414 CCTGCCAGCCCCTCCTGCCCAGG - Intronic
1175573968 20:60046584-60046606 CCTGCCACCCACTCTCACACAGG - Intergenic
1175608389 20:60330125-60330147 GCTGGCAGCCACCAGCACCCAGG + Intergenic
1175802952 20:61811613-61811635 GAGCCCAGCCACTGCCACCCGGG + Intronic
1175995738 20:62811624-62811646 GCTCCCGCCCACCCCCACCCCGG + Intronic
1176081072 20:63273194-63273216 GCTGCCCTCCACCCGCACCCCGG + Intronic
1176150328 20:63587510-63587532 GCTGGCTGCCACCCCCGCCCCGG - Intergenic
1176282255 20:64320291-64320313 TCTGCCCTCCACCCCCACCCCGG + Intergenic
1179414526 21:41187366-41187388 ACTGCCAGCCACACCCTTCCTGG - Intronic
1179679175 21:43005848-43005870 GCTACCAGCCACCTCCTCCCAGG + Intronic
1179884393 21:44307201-44307223 GCTGCCAGCGGCTGCCCCCCGGG - Intronic
1179912534 21:44457712-44457734 CATGCCAGCCTCTCCCACACGGG + Exonic
1180019489 21:45112627-45112649 GCTGCCAGCTCCTCACACCAGGG - Intronic
1180024306 21:45150636-45150658 GCTGCCAGCCACTCTGGCACTGG - Intronic
1180148229 21:45933877-45933899 CCTGCCAGCCACACCCTCCCTGG - Intronic
1180230822 21:46425901-46425923 GCGGCGAGCCACACCCACCCCGG + Exonic
1180671231 22:17555064-17555086 GCTTACAGCCACTCCCACCCAGG - Intronic
1181000889 22:19987280-19987302 CCCGCCCGCCACGCCCACCCCGG - Intronic
1181309692 22:21937883-21937905 GCTGCCAGTCAGCCCCTCCCCGG - Intronic
1183363630 22:37395822-37395844 GCTCCCTGCCCCTCCCACCCTGG - Intronic
1183428265 22:37751104-37751126 TGTGCCAGGCACCCCCACCCAGG - Intronic
1183704792 22:39469818-39469840 AGTGCCAGCCCCTCCCGCCCAGG - Intronic
1184069419 22:42138672-42138694 GCTGCCTGCTAGTCCCACACCGG - Intergenic
1184070307 22:42142933-42142955 TCCGCCACCCACTCCAACCCTGG + Intergenic
1184709089 22:46237587-46237609 GATTCCACCCTCTCCCACCCCGG + Exonic
1184823855 22:46933648-46933670 GCTGCCGGCCAGTGCCACCCTGG - Intronic
1185157791 22:49204769-49204791 CCTGCGACCCACTCCCATCCTGG + Intergenic
1185274855 22:49946083-49946105 GCTGCCAGCCACACCTGCCAGGG - Intergenic
1185393189 22:50573538-50573560 GCTGCCAGCTTCTCCTCCCCAGG + Exonic
950012339 3:9732157-9732179 CCTGCCGGCCACTCCCGCCCTGG - Intronic
950112541 3:10428755-10428777 GGTTCCAGCCACGCCTACCCTGG + Intronic
950207952 3:11094389-11094411 GCTGCCTGCCAGTCCTGCCCTGG - Intergenic
950460603 3:13120114-13120136 GCTGCCAGCGGCTCCCTCCCGGG + Intergenic
950612003 3:14132815-14132837 GCCGCGTGCCACTCCTACCCGGG + Intronic
952616120 3:35276244-35276266 GCTGCCAGCAGCTGCCACCAGGG + Intergenic
953040731 3:39252902-39252924 CCTCCCAGCCACTCCTCCCCAGG - Intergenic
954374002 3:50184827-50184849 GCTCCCGGCCTCTCCCACGCTGG + Intronic
954704508 3:52472031-52472053 ACTGCCAGCCAGTCCCCCGCAGG - Intronic
955161267 3:56467765-56467787 GCGGCCAGCCACCCCACCCCCGG + Intronic
956046402 3:65200536-65200558 GCTGCCAGCCACTGGGAGCCTGG + Intergenic
956487595 3:69739405-69739427 GCCGCCAGCCCCTCCCGCCCGGG + Intergenic
959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG + Intergenic
959847240 3:111048052-111048074 GCTGCCAGGAAGTGCCACCCTGG - Intergenic
959920145 3:111860049-111860071 CCTACCAGACACTCCCTCCCCGG - Intronic
961457180 3:127030060-127030082 TCTGCCAGCCAGGCCCACCTTGG - Exonic
961463676 3:127068755-127068777 CTTCCCAGCCACTCCCGCCCAGG + Intergenic
961476937 3:127152890-127152912 GCTGCCAGCTGCTCCCAGCATGG - Intergenic
961596500 3:128022165-128022187 GCTCAGAGCCACTCCCAACCAGG + Intergenic
961618518 3:128204622-128204644 GCTCCCAGCCACTCCTTTCCTGG + Intronic
961823913 3:129588874-129588896 CCTGCCAGCCACCCCGTCCCAGG - Intronic
962501231 3:135995164-135995186 GCTGCCAGCCCCACCCCCCCAGG - Intronic
962855175 3:139338865-139338887 TTTGCCAGCCTCTCCCAGCCAGG + Intronic
962894690 3:139703859-139703881 TCTGCTAGTCTCTCCCACCCAGG + Intergenic
966597041 3:181733404-181733426 GAGGTCAGCCACTCCCAGCCCGG + Intergenic
967882897 3:194314286-194314308 GCTGGCAGCCTCTCCCTCCCTGG + Intergenic
968266609 3:197367811-197367833 GCCCCCACCCACCCCCACCCAGG - Intergenic
968392617 4:205501-205523 GTGGCCCGCCACCCCCACCCTGG - Intergenic
968566849 4:1317576-1317598 GCTGCTCGCCACTCCCCTCCTGG - Intronic
968733336 4:2282170-2282192 GCTGCCAGACACTCCCGCACCGG + Intronic
968994835 4:3938814-3938836 TGTGCCAGCCCCTCCCAGCCAGG + Intergenic
969114108 4:4860514-4860536 GCCTCCCTCCACTCCCACCCAGG + Intronic
969127537 4:4963719-4963741 CCTGCCAACCACACCCAGCCTGG - Intergenic
969315777 4:6380733-6380755 ACCGCCCGCCACTCCCACCTCGG + Intronic
969428807 4:7140994-7141016 GCTGCCGGCCCACCCCACCCAGG - Intergenic
969511593 4:7620989-7621011 CCTGCCAGCCACTGCCTCCCTGG - Intronic
969530584 4:7728269-7728291 GCTGCCCCCGACCCCCACCCTGG + Intronic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
969591044 4:8122131-8122153 GCTGCAACCCACTCCTCCCCAGG + Intronic
971815060 4:31476785-31476807 TCTCCCAGCCACTCCAACCATGG + Intergenic
972373940 4:38452742-38452764 GATGCCAGCCACTCCCAGACCGG - Intergenic
974108448 4:57498500-57498522 GCTGCCATCTTCTCTCACCCAGG + Intergenic
976813330 4:89120302-89120324 GCAGCCAGCCACACCACCCCTGG - Intergenic
978111106 4:104964590-104964612 GCTCCCAGCCAATGCCAGCCAGG + Intergenic
982170324 4:152655597-152655619 GCTGCCAGCGGCTCCTACCTTGG - Intronic
983409186 4:167375302-167375324 GCTTCCACACACCCCCACCCCGG + Intergenic
984818899 4:183862616-183862638 CGTGCCAGCCTCTCCCGCCCAGG - Intronic
985203322 4:187506021-187506043 GCTGCCTGCCAGTCCCGCGCCGG - Intergenic
985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
985694207 5:1330888-1330910 TCTGCTGGCCACTCCAACCCAGG + Intronic
985788137 5:1910671-1910693 GGTGCCAGCCAGGCCCGCCCCGG + Intergenic
986303034 5:6493510-6493532 GCTGCCACCCAGCCCAACCCGGG - Exonic
988073576 5:26324851-26324873 GCTGCCTGCCAGTCCCACACTGG - Intergenic
988128385 5:27073067-27073089 GCCTCCAGCCACCCCCACCAAGG + Intronic
989188111 5:38644137-38644159 CCTGCCAGGCAGTCCCTCCCCGG - Intergenic
989423409 5:41267656-41267678 ACTTCCAGCCACCCCCACCCTGG + Intergenic
994267885 5:97739345-97739367 CCTGCCAGCCACTGCCTCCTGGG - Intergenic
995021126 5:107368454-107368476 ACTGCCACCCCCTCCCATCCAGG + Intergenic
997446417 5:133943512-133943534 GCTGGGAGCCAGTCACACCCTGG - Intergenic
998391825 5:141792126-141792148 GCTGCCACCTACTCTCACCTGGG - Intergenic
998949895 5:147382861-147382883 GTTGCCAGCCACTCTCCCTCAGG - Intronic
999144524 5:149383546-149383568 GCTGCCCTCCCCTCCCTCCCTGG + Intronic
999192622 5:149759817-149759839 GGGGCCACCCACACCCACCCTGG + Intronic
1000998332 5:167981201-167981223 GCTCCCCGCCATCCCCACCCAGG + Intronic
1001250814 5:170145504-170145526 GCTGGCAGCCTCTGCCACCATGG - Intergenic
1001317426 5:170653834-170653856 CCAGCCTTCCACTCCCACCCTGG + Intronic
1001562232 5:172677318-172677340 GCCGCCAGCCTGTCCCACCAAGG + Intronic
1002315674 5:178341600-178341622 TCTTCCAGCCTCACCCACCCAGG - Intronic
1002560092 5:180075514-180075536 GCTGCCAGCCTCCCACATCCAGG + Intergenic
1002575370 5:180171080-180171102 GCAGCCAGGCACCCCCATCCAGG + Intronic
1002928781 6:1619814-1619836 GCGGCCCGCCACTCCCGCCCGGG + Intergenic
1003035689 6:2638737-2638759 GCTGGGAGGCAGTCCCACCCGGG - Intergenic
1003304241 6:4912154-4912176 ACTGGGAGCCACTCCCACCAGGG - Intronic
1003482613 6:6546934-6546956 GCTGCCAGCCACTCCGCTGCGGG + Intergenic
1004166578 6:13262100-13262122 GCTGCCAGCCTATCCCACTCTGG - Intronic
1004689025 6:17976164-17976186 GCTACCTGCCACTCTCACGCCGG + Intronic
1004865983 6:19854403-19854425 GCTACCTGCCACTCTCACGCCGG + Intergenic
1004953534 6:20701955-20701977 GCTGTCAGCCTCTCCCACCACGG - Intronic
1006390552 6:33755661-33755683 GCTGCCTGCCACACCCACTGGGG + Intergenic
1006440949 6:34053374-34053396 GCTGCCTGCCCCTCCCCCCAGGG + Intronic
1007265173 6:40590392-40590414 GCTCCCTGCCACTCCCAATCAGG + Intergenic
1007304258 6:40892026-40892048 GGTGCCAGCCACGCTGACCCAGG + Intergenic
1007844306 6:44741025-44741047 TGTGCCAGCCCCTCACACCCTGG + Intergenic
1008315145 6:50030522-50030544 CCTGCCCGCCAGTCCCTCCCAGG + Intergenic
1008335936 6:50304700-50304722 GCTGCCTACCGCTCCCACCCCGG + Intergenic
1009289785 6:61868337-61868359 CCTGCCAGGCACTCCATCCCAGG + Intronic
1010238436 6:73594550-73594572 GCTGCCAAGCACTCCCTCCCTGG - Exonic
1011137755 6:84118103-84118125 GCAGCCAGCCTCCCACACCCAGG + Intergenic
1011616550 6:89202945-89202967 CCTGCAAGCAACTCCCACCTAGG + Intronic
1013367327 6:109446086-109446108 GCTCCCACCCTGTCCCACCCTGG + Intronic
1014460266 6:121686672-121686694 GCGGCCGGCCCCGCCCACCCTGG - Intergenic
1016001131 6:139042288-139042310 GGAGCCCCCCACTCCCACCCTGG + Intronic
1016345983 6:143114482-143114504 CCTGCCAACCACTTCCACCTTGG - Intronic
1016354586 6:143204301-143204323 ACTTCCAGCCATTCCCACCAAGG - Intronic
1017427884 6:154341369-154341391 GCTTTCAGCCTCTTCCACCCTGG - Intronic
1017891580 6:158644193-158644215 GCCGCCAGCCCCTCCGCCCCGGG - Intronic
1018172020 6:161151136-161151158 GCTGCCAGCCCCCGCCAGCCAGG + Intronic
1019334391 7:476160-476182 GCTGCCATGGCCTCCCACCCTGG - Intergenic
1019475814 7:1243799-1243821 GCTGCCAGCCCCACCCTCCCTGG - Intergenic
1019659723 7:2217397-2217419 GCTGCCCGGCACCCCCAGCCTGG - Intronic
1019785393 7:2973843-2973865 TCTGCCACCTGCTCCCACCCTGG + Intronic
1022339073 7:29451727-29451749 GCTACAAGCCAATCCCACCAAGG + Intronic
1022796272 7:33734052-33734074 GCTGCCAGCCGGCTCCACCCTGG + Intergenic
1023232553 7:38050060-38050082 GCTGCCTGCCAGTCCCATGCAGG - Intergenic
1023821442 7:43982877-43982899 CCTGCCTGCCTCTCCCAGCCTGG + Intergenic
1023843091 7:44107586-44107608 GCTGCCTGACAACCCCACCCAGG - Intronic
1023856245 7:44185938-44185960 GCTGCCTGCTCCTCCCACACGGG + Intronic
1023904488 7:44512725-44512747 GCTGCCAGTCAAGGCCACCCAGG - Exonic
1023945101 7:44796838-44796860 GCTACCACCCACCCCGACCCCGG - Intronic
1024419763 7:49150421-49150443 GCTGGCAGCCACCAGCACCCAGG + Intergenic
1024513455 7:50221275-50221297 GCTCCCAGCCCCTCCCTCTCTGG + Intergenic
1028109973 7:86928490-86928512 ACCGCCCGCCACTCCCACCTGGG - Intronic
1028725462 7:94082253-94082275 GCTGTTAGCAACTCCCAGCCAGG + Intergenic
1028857567 7:95608867-95608889 GCAGCCAGGCAGTCCCGCCCAGG - Intergenic
1028985678 7:97006577-97006599 CCTGCCGGCCTCTCCCAGCCGGG + Intronic
1029749705 7:102536298-102536320 CCTGCCTGCCTCTCCCAGCCTGG + Intergenic
1029767655 7:102635403-102635425 CCTGCCTGCCTCTCCCAGCCTGG + Intronic
1031557657 7:123198294-123198316 CCACCCTGCCACTCCCACCCCGG - Intronic
1031984874 7:128157544-128157566 GCTCCCATCCACTCCCACCCTGG - Intergenic
1032044143 7:128589240-128589262 ACTGCCAGCCTCTGCCTCCCGGG + Intergenic
1032425636 7:131820210-131820232 TCTGCCTGCCCCTCCCACTCTGG + Intergenic
1032544448 7:132729975-132729997 TCTGCCCACCACTCCCACCATGG + Intergenic
1034063159 7:148111230-148111252 CCTGCCACCCACCCCTACCCTGG - Intronic
1034133913 7:148747510-148747532 GCTCTCAGCCCCTCCCAGCCAGG - Intronic
1034197851 7:149262013-149262035 GCGGCCACCCACCCTCACCCGGG - Intergenic
1034306466 7:150048375-150048397 GCTGCCAACCCCTGCCACCCAGG - Intergenic
1034800380 7:154052267-154052289 GCTGCCAACCCCTGCCACCCAGG + Intronic
1034879847 7:154755234-154755256 GCTGCCTGCCTGTCCGACCCTGG + Intronic
1034900919 7:154907291-154907313 GCTGCCCGCCAGTCCCACGCAGG - Intergenic
1035928231 8:3752653-3752675 ACTGCCACCCACTCCCCGCCTGG + Intronic
1037535098 8:19816937-19816959 GCTGCCTGCGACTCACTCCCCGG - Intergenic
1037734772 8:21557004-21557026 GCTGCTTCCCAGTCCCACCCAGG + Intergenic
1038577524 8:28717676-28717698 GATCCCAGCCGCTCCCATCCGGG + Exonic
1039620946 8:38996734-38996756 GCTGCCGGGCACGCCCACCTAGG - Intronic
1039893369 8:41699199-41699221 GCTCCCCTCCTCTCCCACCCAGG - Intronic
1039934555 8:42030325-42030347 GCTCCAAGCCAATCCCAGCCAGG + Intronic
1040014546 8:42689903-42689925 GCTGCCTGCCAGTCCCGCACCGG - Intergenic
1042376266 8:68056242-68056264 CCTGCCTGCCACTCCCTGCCTGG - Intronic
1042793345 8:72633205-72633227 GCTCCCACCCACTGCCAGCCAGG - Intronic
1046560217 8:115827086-115827108 TCTGCCAGCCTCAGCCACCCAGG + Intergenic
1047100121 8:121667415-121667437 GCTGCCTGCCAGTCCCGCGCTGG + Intergenic
1047630172 8:126698326-126698348 GCTGTCAGCCACCACCACGCTGG - Intergenic
1048573728 8:135675327-135675349 ACTGCCAACCTCTGCCACCCAGG + Intergenic
1048985418 8:139732311-139732333 GCTGCCACCCACTCCCTGCCAGG + Intronic
1048986105 8:139735922-139735944 CCTGCCAACCCCTACCACCCTGG - Intronic
1049306042 8:141904832-141904854 GCTGCCTGCCCCTCCCTGCCTGG - Intergenic
1049326244 8:142022990-142023012 GCTGACACCCACCCCCACCATGG - Intergenic
1049574967 8:143385717-143385739 GGTGCCGGCCCCTCCCTCCCAGG - Intergenic
1049648889 8:143754177-143754199 GCTGCAAGCCCCTCCCCCTCTGG - Intergenic
1049662233 8:143824622-143824644 GCTGCCAGCGAGTCCCAGCGGGG + Intronic
1050027959 9:1355206-1355228 GCTGGCTCCCACCCCCACCCAGG - Intergenic
1051452907 9:17216904-17216926 GCTGCCAGGCAGTTCCACCCAGG + Intronic
1052360593 9:27552422-27552444 GCTGCCAACCTCTGCCTCCCGGG + Intronic
1053366194 9:37524174-37524196 TCCTCCAGCCACTCCCACTCAGG + Intronic
1055620782 9:78122814-78122836 TCTGGCCGCCACTCCCTCCCTGG + Intergenic
1057303266 9:93898648-93898670 CCTGTCAGCCACTTCCAGCCTGG - Intergenic
1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
1059024982 9:110616772-110616794 GCTGGCAGCCACTGCTACCTGGG - Intergenic
1059257668 9:112945751-112945773 TCTGCCAGCCGCTGCCGCCCGGG - Intergenic
1059314119 9:113409995-113410017 CCAGCCAGCAACTCCCAGCCAGG + Intronic
1059343454 9:113612704-113612726 GCTGCCACCCATTCCCTCCTGGG - Intergenic
1060976104 9:127766156-127766178 GCTGCCATCCTGCCCCACCCTGG + Intronic
1060996239 9:127876199-127876221 TCTGCCCTCCACTCCCACACTGG + Intronic
1061534367 9:131238587-131238609 GGAGCCAGCTGCTCCCACCCTGG - Intergenic
1061892483 9:133630098-133630120 TCTGCCCCCCCCTCCCACCCTGG + Intergenic
1062026136 9:134341625-134341647 GCTGCGAGCCAGCCCAACCCTGG - Intronic
1062040392 9:134401837-134401859 GGTGCCCACCACACCCACCCTGG + Exonic
1062053921 9:134461044-134461066 GCTGACAGCCACACCCATCCAGG - Intergenic
1062179434 9:135183069-135183091 TCCGCCAGCCCCTCCCACCCTGG + Intergenic
1062221997 9:135421450-135421472 GATAGCAGACACTCCCACCCAGG + Intergenic
1062237045 9:135515312-135515334 ACTGCCTGCCACTCCCCTCCCGG + Intergenic
1062287057 9:135778003-135778025 GCTCCCAGCTCCTCCCACTCTGG + Intronic
1062396991 9:136356563-136356585 GCCGCGAGCCACGCCCGCCCAGG - Intronic
1062628987 9:137455210-137455232 CCTGCCAGCCACTCGCCACCAGG - Intronic
1062717319 9:138017769-138017791 GATGCCAGCCAGTCACTCCCTGG - Intronic
1185729663 X:2451290-2451312 GATGCAAGCCCCTTCCACCCTGG + Intronic
1185730364 X:2456672-2456694 GATGCAAGCCCCTTCCACCCTGG + Intronic
1185765967 X:2726182-2726204 TCTGCCAGCCACTGCCCCCTGGG + Intronic
1186917162 X:14235221-14235243 GCTGCAAGCCCCTCCCACTCTGG + Intergenic
1187445937 X:19361098-19361120 GCCTCCACCCACTCCCAGCCAGG + Exonic
1189303402 X:39969288-39969310 GCCGCCAGCCTCCCCCAGCCCGG + Intergenic
1190520419 X:51273701-51273723 GCTGCCAGCAACTGCCACTCTGG + Intergenic
1190877793 X:54471770-54471792 GCTCACAGCCACCCCCAGCCTGG - Intronic
1192884368 X:75320925-75320947 GCTCCCAGCCAGTCCAACACAGG - Intergenic
1195115572 X:101695071-101695093 GCTGGCAGCCAGTCCCACTAGGG - Intergenic
1195972577 X:110489897-110489919 ACTGCCAACCTCTGCCACCCGGG + Intergenic
1197102271 X:122670589-122670611 CCTGCCAGCCAATCCAACCCAGG + Intergenic
1197692267 X:129514768-129514790 GGTGTGAGCCACCCCCACCCTGG - Intronic
1199292007 X:146114622-146114644 GCTGCCAGCCAATTCCAGCCAGG + Intergenic
1199396834 X:147347811-147347833 GCTGAAAGCCACTCCCAGCCAGG - Intergenic
1200235933 X:154467721-154467743 GCTGACCACCACGCCCACCCTGG - Intronic
1200277912 X:154751321-154751343 GGCGCCTGCCACTCTCACCCAGG + Intronic
1200919083 Y:8597129-8597151 GGTGCCAGGCAGTCCCATCCAGG - Intergenic