ID: 1076805965 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:132858861-132858883 |
Sequence | GGCAACGGGGGCTCCCCCGA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 100 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 4, 4: 94} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076805953_1076805965 | 12 | Left | 1076805953 | 10:132858826-132858848 | CCGCAGGGCTGGGGCCAGAAGGA | No data | ||
Right | 1076805965 | 10:132858861-132858883 | GGCAACGGGGGCTCCCCCGACGG | 0: 1 1: 0 2: 1 3: 4 4: 94 |
||||
1076805957_1076805965 | -2 | Left | 1076805957 | 10:132858840-132858862 | CCAGAAGGAGGCCCTGTCAGGGG | No data | ||
Right | 1076805965 | 10:132858861-132858883 | GGCAACGGGGGCTCCCCCGACGG | 0: 1 1: 0 2: 1 3: 4 4: 94 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076805965 | Original CRISPR | GGCAACGGGGGCTCCCCCGA CGG | Intronic | ||