ID: 1076805965

View in Genome Browser
Species Human (GRCh38)
Location 10:132858861-132858883
Sequence GGCAACGGGGGCTCCCCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076805953_1076805965 12 Left 1076805953 10:132858826-132858848 CCGCAGGGCTGGGGCCAGAAGGA No data
Right 1076805965 10:132858861-132858883 GGCAACGGGGGCTCCCCCGACGG 0: 1
1: 0
2: 1
3: 4
4: 94
1076805957_1076805965 -2 Left 1076805957 10:132858840-132858862 CCAGAAGGAGGCCCTGTCAGGGG No data
Right 1076805965 10:132858861-132858883 GGCAACGGGGGCTCCCCCGACGG 0: 1
1: 0
2: 1
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076805965 Original CRISPR GGCAACGGGGGCTCCCCCGA CGG Intronic