ID: 1076806032

View in Genome Browser
Species Human (GRCh38)
Location 10:132859235-132859257
Sequence CAGGCTCAGGCACCTGACGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076806026_1076806032 5 Left 1076806026 10:132859207-132859229 CCGCTGAGTGCTGCGCAACTCTG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG 0: 1
1: 0
2: 2
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076806032 Original CRISPR CAGGCTCAGGCACCTGACGG AGG Exonic
900589761 1:3454427-3454449 AAGGCGCAGGCACCGGGCGGCGG + Exonic
900598192 1:3491869-3491891 CAGCCTCAGGGTCCTGAAGGTGG + Intronic
901002269 1:6154696-6154718 CAGGCTGGGGCACCTGCGGGGGG + Exonic
901138013 1:7010056-7010078 CAGGCTCAGGCACTTGCCAGGGG + Intronic
901642847 1:10701781-10701803 TAGGACCAGGCAGCTGACGGGGG + Intronic
901692167 1:10980701-10980723 CAGGAGCAGGCATCAGACGGAGG - Intronic
902397264 1:16139152-16139174 GGGGCTCAGGCACCTGACTCCGG + Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
903879179 1:26497143-26497165 CTGGCTCAGTCACCTGATGGGGG - Intergenic
904289908 1:29478362-29478384 AAGGCTCAGGCGGCTGACTGGGG + Intergenic
905865519 1:41374311-41374333 CAGGGTCAGTCTCCTGAGGGAGG + Intronic
907299540 1:53477912-53477934 CTGGCTCAGGCAGCTGGAGGTGG - Intergenic
915910466 1:159911916-159911938 CAGGGTCAGCCACCTCACAGGGG + Intergenic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
918012814 1:180603527-180603549 CAGTCTCAGGCAGCTCACTGTGG - Intergenic
918067888 1:181113663-181113685 AAGGCACAGAGACCTGACGGTGG - Intergenic
919642226 1:200056866-200056888 CAGATTCAGACACCTGACGATGG - Intronic
921360840 1:214329836-214329858 CAGGCAGAGGCAGCTGAGGGAGG + Intronic
921861501 1:220046582-220046604 CAGGCTCTGGAACCTGCGGGCGG - Exonic
924179176 1:241424150-241424172 CGGGCTGAGGCACCTGCCGGCGG + Intergenic
1063473453 10:6307689-6307711 CAGGCTGTGGCACCAGACGGTGG - Intergenic
1064617934 10:17181990-17182012 CTGGCTCAGGCACTTGACCGAGG - Intronic
1067064072 10:43093882-43093904 CAGGCGCAGGCTCCTGCTGGTGG + Intronic
1067546078 10:47193488-47193510 CAGGCTCAGTGACCTGCCCGAGG - Intergenic
1067689137 10:48490129-48490151 CAGACTCATGCACCTGTAGGGGG + Intronic
1067732468 10:48821879-48821901 CAGGTCCAGGCACCTGACTAGGG - Intronic
1068955860 10:62818218-62818240 CAGCCTCAGGGCCCTGACCGCGG - Intronic
1071456797 10:85857365-85857387 CAGGCTCAGCCTCCTGAGTGTGG + Intronic
1075161709 10:120030100-120030122 CAGGTTCAGGCACCTGCTGGGGG + Intergenic
1076600905 10:131656398-131656420 CAGGCTGAGGCAGGTGAGGGTGG - Intergenic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1077919562 11:6632423-6632445 CAGGCCCAAGCACCAGATGGGGG - Exonic
1082281209 11:50273225-50273247 CAGGGTCAGGCACCTGCTGAGGG - Intergenic
1085454908 11:76660243-76660265 CAGGCTCAGGCTGCGGAGGGAGG + Exonic
1089390515 11:118098707-118098729 CAGGCTCAGGCAAGACACGGGGG + Intronic
1091327614 11:134703009-134703031 CAGGCTCAGGCTGCTGAGGAAGG + Intergenic
1091636335 12:2199722-2199744 CATGCTCTGGGACCTGACAGAGG - Intronic
1092746240 12:11675013-11675035 CTGTCTCAGGGAGCTGACGGAGG - Intronic
1102542469 12:113632243-113632265 CAGGCTCTGGCACCTGTCCCTGG + Intergenic
1102565888 12:113797296-113797318 CAGGGTCAGGCACCACACGTGGG - Intergenic
1104040264 12:125125375-125125397 CCAGCTCTAGCACCTGACGGTGG - Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1112508353 13:99988902-99988924 CAGGCCCAGGCTCCTGAGTGTGG - Intergenic
1114500581 14:23165424-23165446 CAGCCTCAGGAACCTGAAGGAGG + Exonic
1119614602 14:76090881-76090903 CAGGCTCAGGAACATGACCTTGG - Intergenic
1122217028 14:100211546-100211568 CAGGCTGAGGCACCTGGGGCTGG - Intergenic
1122971227 14:105153023-105153045 CAGGCTCTCTCCCCTGACGGAGG - Intronic
1123813866 15:23956398-23956420 CAGTCTCAGGCTCCTGAGGCCGG - Intergenic
1124101863 15:26703241-26703263 CAGGCACCGGCACCTGGTGGGGG + Intronic
1125396379 15:39252580-39252602 CAGGCTCATGCTGCTGACAGGGG + Exonic
1127982567 15:64045809-64045831 CAGGCCGGGGCGCCTGACGGCGG + Intronic
1128387170 15:67158020-67158042 CAGTCTCAGGAACCTGCCGTTGG - Intronic
1129740318 15:77986737-77986759 CAGGCTCAGGCATGTGCCCGAGG - Intronic
1129845434 15:78765860-78765882 CAGGCTCAGGCATGTGCCCGAGG + Exonic
1132116387 15:99139042-99139064 CAGGCTAAGGCACCTGCTGCAGG - Intronic
1132879173 16:2153789-2153811 CATGCTCAGGCAGCTAAGGGAGG + Exonic
1133934891 16:10260789-10260811 TGGGCTCAGGGACCTGACCGTGG + Intergenic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1136187309 16:28595934-28595956 CTGGCTCTGGCCCCTGACGCAGG - Exonic
1136189790 16:28608859-28608881 CTGGCTCTGGCCCCTGACGCAGG - Exonic
1136370914 16:29835560-29835582 CAGGCTCAAGTTCCTGACTGCGG - Intronic
1139424054 16:66868053-66868075 CAGGCTCAGGCCCCGGGTGGTGG - Intronic
1141725836 16:85787787-85787809 CAGGCACAGGATCCTGAGGGAGG - Intronic
1143536297 17:7542074-7542096 CAGGCTCAGGCCGCTTGCGGTGG + Intergenic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1145295874 17:21592566-21592588 GAAGCTGAGGCCCCTGACGGAGG + Intergenic
1146385381 17:32367769-32367791 CAGGCTCAGGCAGCTGTCCAAGG + Exonic
1146460150 17:33039797-33039819 CAGGATCAGGCAGGTGAAGGAGG - Intronic
1146914903 17:36672198-36672220 CTGGCTGAGGCACCAGACTGGGG - Intergenic
1147303640 17:39548854-39548876 CAGGCTAAGGGACATGACAGAGG + Intronic
1148793551 17:50186734-50186756 CTGGCTCAGGCTCTTGAGGGTGG + Exonic
1150699301 17:67433747-67433769 CAGGCTCAGGAGGCTGACGCAGG + Intronic
1151192400 17:72408060-72408082 CAGGTTAAGTCACCTGACTGAGG + Intergenic
1151918085 17:77133463-77133485 CAGACTCAGGCTCCTAATGGGGG + Intronic
1153174827 18:2359214-2359236 CAGGTCCAGGCACATGAGGGTGG - Intergenic
1153769204 18:8401699-8401721 AAGGCTCGGGCCCCTGACGGAGG + Intronic
1154490729 18:14919999-14920021 CAGGCTCAGCCACTTGATGTGGG + Intergenic
1159115443 18:64107908-64107930 CAGGCTCAGGCCATTGAAGGTGG + Intergenic
1159909105 18:74127008-74127030 CAGGGTCAGGAACCTCACTGTGG + Intronic
1160277156 18:77447814-77447836 CAGGTCCAGGCAGCTGAGGGAGG + Intergenic
1162367766 19:10259633-10259655 CATGCTCAAGCACCAGACGCTGG + Exonic
1162874405 19:13610141-13610163 CAGGCGCAGGCACCTGGCTGGGG - Intronic
1163208222 19:15819836-15819858 CATGTTCAGCCACCTGAGGGAGG + Intergenic
1164605343 19:29593926-29593948 CAGGCTCAGCCTCCTGCCGCTGG + Intergenic
1164888748 19:31805183-31805205 GAGGAGCAGGCACCTGACGTGGG + Intergenic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1167217135 19:48172068-48172090 CAGGTTCACGCACCCCACGGCGG - Exonic
1167489351 19:49782625-49782647 CAGGGCCAGGCACATGAAGGTGG - Exonic
1167801650 19:51746794-51746816 CAGGTTCAGGTAACTGATGGTGG + Exonic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
925640324 2:5980921-5980943 CAGGCACAGGCTCCTCACGTGGG + Intergenic
926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG + Intergenic
932354508 2:71058158-71058180 CAAGCTCAGAGACCTGACAGTGG - Intergenic
937289944 2:120776108-120776130 CCTGCCCAGGCACCTGATGGGGG - Intronic
939545658 2:143549630-143549652 CAGGCTCAAGCACCTGCTGTAGG - Intronic
944170560 2:196772318-196772340 GAGGCTGAGGCACCTGAGGTCGG + Intronic
944596560 2:201266545-201266567 CAGGCTCAGGAACTTGAGGGAGG - Exonic
944842195 2:203635122-203635144 CAGGCTCAGGCAGCTGTCCAAGG - Intergenic
948171463 2:235906669-235906691 CAGGCTCACCCACCTGACCATGG + Intronic
948733185 2:239980041-239980063 AGGTCTCAGGCACCTGACGCAGG - Intronic
948980549 2:241492254-241492276 CGGGCTCAGCCCCCTCACGGGGG - Intronic
1172098650 20:32473018-32473040 CAGGATCAGGTAGCTGACAGTGG - Intronic
1173355092 20:42279850-42279872 CAGGGTCAGGGACCAGACAGCGG + Intronic
1173861662 20:46287826-46287848 CATTCTCAGCCACCTGATGGGGG - Intronic
1175893824 20:62327292-62327314 CAGCCTCAGGCACGTGCCGCAGG + Exonic
1176555718 21:8253286-8253308 CCGGCTCCGACCCCTGACGGCGG - Intergenic
1178103514 21:29295514-29295536 CAGGCTCAGCCACATGAGAGGGG + Intronic
1178365311 21:31985236-31985258 CAGGCTCAGTGACCTCACTGGGG - Intronic
1178534142 21:33398783-33398805 CAGGCTCCAGCACCGGACAGGGG - Intergenic
1179176872 21:39014246-39014268 CAGTGCCAGGCACCTGACAGTGG - Intergenic
1181057235 22:20265961-20265983 CTGGCTCAGCCACCTGCTGGCGG - Intronic
1182354666 22:29717224-29717246 GAGGCTCAGGCATCTCCCGGTGG + Intergenic
1182685439 22:32119542-32119564 CTGGCTCAGGCCCCAGAAGGAGG + Intergenic
1182686526 22:32124385-32124407 CTGGCTCAGGCACCCGCAGGAGG - Intergenic
1183080329 22:35451943-35451965 CAGGATCAGGCACCTGAAAGGGG - Intergenic
1183359289 22:37375174-37375196 CAAGCTCAGCAACCTGACGGAGG - Exonic
1183580989 22:38726664-38726686 CCTGCTCAGGCACCAGAGGGAGG - Intronic
1185106099 22:48870737-48870759 TAGGCTGAGGCACCTGAGGCAGG + Intergenic
1185366821 22:50440646-50440668 CAGGCTCACGCACCTGCCATGGG - Intronic
951057851 3:18168652-18168674 CAGGCATAGGCACCTGACTTAGG + Intronic
953843451 3:46408018-46408040 CAGGATAAGGCAGCTGTCGGAGG + Intronic
956004497 3:64763931-64763953 CCAGCTCAGGCACTTGACTGAGG + Intergenic
959085770 3:101849535-101849557 CTGGCTCAGGGAGCTGTCGGCGG - Exonic
959653909 3:108779294-108779316 CAGGTCCAGGCAGCTGACTGAGG + Intergenic
965795821 3:172437723-172437745 CAGGCTCAGTCAACAGAAGGTGG - Intergenic
966747996 3:183296554-183296576 CAGGGTCAGGCATGTGACAGAGG - Intronic
968483606 4:848378-848400 GAGGCTCAGGCCCCTGACGGAGG + Intergenic
968862619 4:3184725-3184747 CAGGCTCATACACCTGATGCTGG - Intronic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
969468487 4:7371800-7371822 CACGCCCAGGCCTCTGACGGAGG + Intronic
969561213 4:7949642-7949664 GAGGCTGGGGCAGCTGACGGGGG - Intergenic
977571632 4:98635071-98635093 CAGGAGCAGGCAGCTGATGGTGG - Intronic
983987195 4:174073698-174073720 CAGGCTCAGCCAGCAGAAGGAGG - Intergenic
985931776 5:3064085-3064107 CAGGCTCAGCCTCCTGGTGGAGG - Intergenic
997660721 5:135587564-135587586 CAGTCTCTGGCAGCTGATGGAGG + Intergenic
998442709 5:142175598-142175620 CAGGGCCAGGGACCTGAAGGTGG + Intergenic
1001980419 5:176034258-176034280 CTGGCTCAGGCACCAGCAGGAGG + Intronic
1002237042 5:177809807-177809829 CTGGCTCAGGCACCAGCAGGAGG - Intergenic
1002375528 5:178786314-178786336 CCAGCTCTGGCACCTGACAGTGG + Intergenic
1003756694 6:9128817-9128839 CAGGCCCAGACACCTGACCTTGG + Intergenic
1003868064 6:10381478-10381500 CAGGCTCGGGGACCTGCCGCAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006410623 6:33871274-33871296 CTGGCTCAGGCTCCAGAAGGTGG - Intergenic
1009265529 6:61550207-61550229 CAGACACTGGGACCTGACGGTGG - Intergenic
1012994362 6:105958777-105958799 CGGGCTCAGGCACCTGCCATAGG - Intergenic
1013290605 6:108716005-108716027 CAGGCTCACGCATCTGACACTGG + Intergenic
1017464010 6:154677915-154677937 CAGGCTCCAGCAGCAGACGGTGG + Intergenic
1018922352 6:168184112-168184134 CAGGCTCTGGGACCAGAAGGAGG + Intergenic
1019196910 6:170288443-170288465 CACCCAGAGGCACCTGACGGTGG - Exonic
1019215529 6:170440505-170440527 GAGACCCAGGCTCCTGACGGAGG - Intergenic
1025809685 7:64867911-64867933 CAGGCTCAGGCATCTGATGATGG - Intergenic
1026428730 7:70322961-70322983 CAAGCTCAGGCCCCAGATGGGGG + Intronic
1026830580 7:73607610-73607632 CAGCCTCAGGCCCCTGCAGGGGG + Exonic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1033207618 7:139436424-139436446 CAGGCTCAGGCACCCGCCTCTGG - Intergenic
1034129045 7:148698971-148698993 CAGGCCCAGGGACCAGGCGGAGG + Exonic
1034210557 7:149358838-149358860 CAGGCTGAGTCACCTATCGGTGG - Intergenic
1035268152 7:157703641-157703663 CAGGCAGAGGCACCTGCAGGAGG + Intronic
1038521168 8:28233399-28233421 GAGGCTCAGGAACCTCACGGGGG + Intergenic
1040079919 8:43275519-43275541 CAGGCCCAGGCCCCTGCCGAGGG - Intergenic
1043544056 8:81295408-81295430 CAGGCTCAGGAACCAGAGGCAGG + Intergenic
1057081021 9:92174756-92174778 AAGCCTCAGACACCTGAGGGAGG - Intergenic
1060520664 9:124292233-124292255 CTGGCTCAGCCACCTGCTGGTGG + Intronic
1060722043 9:125986027-125986049 CAGGCTCGGGGACCTGCCGGTGG - Intergenic
1061062085 9:128255499-128255521 CAGGCTCAGGCAGGCGAGGGAGG + Intergenic
1062539338 9:137034706-137034728 CAGGCTCTGGCACCAGAGGCCGG - Exonic
1192138861 X:68630815-68630837 CAGGCCGTGGCAGCTGACGGTGG - Intergenic
1195796429 X:108653317-108653339 CAGGTTCAGGCATCCAACGGGGG - Intronic
1200097046 X:153669340-153669362 CAGTCCCAGGCACCTGGCTGAGG + Intergenic