ID: 1076807782

View in Genome Browser
Species Human (GRCh38)
Location 10:132867795-132867817
Sequence GGCCCCGCTGTGCCTCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076807773_1076807782 2 Left 1076807773 10:132867770-132867792 CCATCTCTCCGGCGTGCCCAGCC 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG No data
1076807772_1076807782 8 Left 1076807772 10:132867764-132867786 CCGACTCCATCTCTCCGGCGTGC 0: 1
1: 0
2: 1
3: 2
4: 89
Right 1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG No data
1076807775_1076807782 -6 Left 1076807775 10:132867778-132867800 CCGGCGTGCCCAGCCCCGGCCCC 0: 1
1: 1
2: 8
3: 176
4: 1305
Right 1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076807782 Original CRISPR GGCCCCGCTGTGCCTCCCGC GGG Intronic
No off target data available for this crispr