ID: 1076808064

View in Genome Browser
Species Human (GRCh38)
Location 10:132869214-132869236
Sequence GTCTCGCCCTTGGTGCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076808064_1076808070 -1 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808070 10:132869236-132869258 CTCAAACCCCAGGCGGCGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1076808064_1076808069 -2 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808069 10:132869235-132869257 ACTCAAACCCCAGGCGGCGCAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1076808064_1076808076 7 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808076 10:132869244-132869266 CCAGGCGGCGCAGGGTGGGACGG 0: 1
1: 0
2: 2
3: 46
4: 385
1076808064_1076808077 18 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808077 10:132869255-132869277 AGGGTGGGACGGCACACACCTGG 0: 1
1: 0
2: 1
3: 10
4: 198
1076808064_1076808068 -8 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808068 10:132869229-132869251 GGCGAGACTCAAACCCCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 83
1076808064_1076808072 3 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808072 10:132869240-132869262 AACCCCAGGCGGCGCAGGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 119
1076808064_1076808071 2 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808071 10:132869239-132869261 AAACCCCAGGCGGCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076808064 Original CRISPR GTCTCGCCCTTGGTGCGGCC AGG (reversed) Intronic
900616825 1:3569249-3569271 GTCTGGGCATTGGTGTGGCCTGG - Intronic
900658619 1:3772335-3772357 GGCTCGCCCTTGGGGCCTCCAGG - Intergenic
904310129 1:29623778-29623800 GTCTCCTCCTGGGTGCTGCCTGG + Intergenic
912572903 1:110637589-110637611 GTCTGCCCCTGGGTGGGGCCTGG + Intergenic
912879148 1:113391005-113391027 GTCTCCCCCATGGTGCAGCGGGG + Exonic
918109589 1:181443728-181443750 GTCTCTCCAATGGTGAGGCCAGG + Intronic
1065493753 10:26308344-26308366 GTCTCCCACGTGGTGTGGCCGGG + Intergenic
1067237877 10:44466943-44466965 GTCCCGCCTGTGGTGCGTCCTGG + Intergenic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1078931180 11:15913038-15913060 GCCTCGCCCTTACTGGGGCCAGG + Intergenic
1084308318 11:68300678-68300700 ACCTCGCCCTTGGTGGGGGCCGG + Intergenic
1084394064 11:68897295-68897317 GTCTCGCCCTCGGTCAGGCCGGG - Intronic
1087229128 11:95640128-95640150 TTTCCGCCCTTGGTGGGGCCAGG + Intergenic
1092605271 12:10111712-10111734 GACTCGCCCTCGGGGCGGCCTGG - Intergenic
1095360065 12:41326590-41326612 CTCTCGCCCTTGCTGAGGCTGGG - Intronic
1100166630 12:91924170-91924192 GTCCCGCACTCGGAGCGGCCGGG - Intergenic
1101592888 12:106139164-106139186 GACTCGCCCTTTGTGCGGCGCGG + Exonic
1107031092 13:35854442-35854464 GTCTCAGCCTTGGTGCAGACAGG - Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1124441265 15:29687954-29687976 CTCTGGCCCTTAGTGGGGCCAGG - Intergenic
1125350178 15:38758444-38758466 GCCTCGCCCTTTGCGAGGCCTGG + Intergenic
1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG + Intronic
1125513842 15:40307195-40307217 GTCTTGCCCTTGCTCCGGCAGGG - Intronic
1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG + Intergenic
1132050212 15:98601512-98601534 GACTCTGCCTTGGTGGGGCCGGG - Intergenic
1132491714 16:235225-235247 CTTTCGCTCTTGGTGCCGCCTGG + Intronic
1132875513 16:2135360-2135382 GCCTCGCCCTGGGAGCGTCCTGG + Intronic
1134519474 16:14912000-14912022 GCCTCGCCCTGGGAGCGTCCTGG - Intronic
1134554462 16:15154235-15154257 GCCTCGCCCTGGGAGCGTCCTGG + Intergenic
1134707144 16:16310655-16310677 GCCTCGCCCTGGGAGCGTCCTGG - Intergenic
1134960396 16:18401469-18401491 GCCTCGCCCTGGGAGCGTCCTGG + Intergenic
1138105485 16:54285402-54285424 TTCTCGCCCTTGGTGGGGTAGGG + Exonic
1138179593 16:54932663-54932685 TTCTCGCCCTTGGTGGGGTAGGG - Exonic
1139371139 16:66470135-66470157 GACCAGCCCTTGGTGCAGCCTGG - Intronic
1144472991 17:15561256-15561278 GTCGAGCCCTTAGTGCTGCCAGG - Intronic
1144923489 17:18783444-18783466 GTCGAGCCCTTAGTGCTGCCAGG + Intronic
1149495731 17:57116123-57116145 GTGCCGCCCCTGGTGCGGACGGG + Exonic
1151758560 17:76088249-76088271 CTCTCCCCCTTGGTCCAGCCTGG - Intronic
1152239080 17:79152253-79152275 GTCTCGCCCCGGGGGTGGCCAGG - Intronic
1152556753 17:81057140-81057162 GCCCCGCCCTTTCTGCGGCCTGG + Intronic
1154502648 18:15004368-15004390 GTGTCCCCATGGGTGCGGCCTGG - Intergenic
1160802273 19:975666-975688 GTCTCGCCCTGGCCGCGGCAGGG + Exonic
1161793164 19:6372911-6372933 GACGCGGCCGTGGTGCGGCCTGG + Exonic
1163102609 19:15107422-15107444 GGCTCGGCCATGCTGCGGCCCGG - Exonic
1168176896 19:54633033-54633055 GTCTCCCTCTCGGTGCAGCCGGG + Exonic
925914969 2:8598263-8598285 GTGTGGCCCTTGGTGATGCCTGG - Intergenic
936566065 2:113583724-113583746 CCCTCGCCCTGGGTGCGCCCCGG - Intergenic
943459014 2:188146474-188146496 GTCTCACCCTTGCTGCTGTCTGG + Intergenic
948179286 2:235966834-235966856 GTCTCTGCCTTAGGGCGGCCAGG + Intronic
1170635287 20:18099119-18099141 GCCTCACCCTTGGTGTTGCCTGG + Intergenic
1173499087 20:43539405-43539427 GCCTCCCCCTTGGTGGGGCCTGG - Intronic
1175925130 20:62467666-62467688 GTCTGGCCCTGGCTGCCGCCGGG - Intronic
1180151677 21:45951390-45951412 GTTTAGCCCCTGGTGCTGCCTGG - Intergenic
961771419 3:129252823-129252845 CTCTGGCCCTTGGTGAGCCCGGG + Intronic
970909942 4:21263209-21263231 GTCTCTACCTTAGTGCTGCCTGG - Intronic
972321536 4:37977303-37977325 GTCGCGCCCGCGGGGCGGCCAGG - Intronic
973279031 4:48341099-48341121 GTCTCGCCCTTGTTCCGGGCCGG - Intergenic
978385404 4:108172194-108172216 GTCTTCCCCTTTGTGTGGCCTGG + Intergenic
984864691 4:184271700-184271722 GGCAAGCCCTTGGTGAGGCCAGG + Intergenic
985782757 5:1879716-1879738 TTCTCGCCCTTGGTGGGGTAGGG + Exonic
985895828 5:2749597-2749619 TTCTCGCCCTTGGTGGGGTAGGG + Exonic
985996354 5:3599405-3599427 TTCTCGCCCTTGGTGGGGTAGGG - Exonic
997266905 5:132500276-132500298 ATCTCGCTTTTGGTGTGGCCTGG + Intergenic
997980615 5:138465596-138465618 GACTCGCCCTGGGCGCGGGCGGG - Exonic
999726934 5:154445704-154445726 GTCTGGCCCTCGGTCCAGCCAGG + Intergenic
1001536977 5:172504901-172504923 GGCTTGCCCTGGGAGCGGCCAGG + Intergenic
1006579563 6:35068992-35069014 GTCTGGCCATTGGTGGGCCCAGG + Intronic
1007320016 6:41021354-41021376 CTCTCACCCTTGGTGCAGTCAGG - Intergenic
1020107521 7:5428930-5428952 GTCTCGCCCTTGTGGCTGCCTGG + Intergenic
1023987014 7:45102633-45102655 CCCTGGCCCTTGGTGAGGCCTGG + Intronic
1024508634 7:50184949-50184971 GCCTTGCCCCTGGTGCAGCCGGG + Intergenic
1049427239 8:142542926-142542948 GTCCAGCCCTTGGGGCAGCCTGG + Intronic
1054720377 9:68597340-68597362 GTCTAGCCCTTGGTTCTGGCTGG + Intergenic
1062067847 9:134538368-134538390 GTCCAGCCCTTGGAGGGGCCTGG + Intergenic
1186883068 X:13885688-13885710 GCCTGGCCCTTGGTGGGGCGGGG - Intronic