ID: 1076808064

View in Genome Browser
Species Human (GRCh38)
Location 10:132869214-132869236
Sequence GTCTCGCCCTTGGTGCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076808064_1076808069 -2 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808069 10:132869235-132869257 ACTCAAACCCCAGGCGGCGCAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1076808064_1076808072 3 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808072 10:132869240-132869262 AACCCCAGGCGGCGCAGGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 119
1076808064_1076808070 -1 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808070 10:132869236-132869258 CTCAAACCCCAGGCGGCGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1076808064_1076808077 18 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808077 10:132869255-132869277 AGGGTGGGACGGCACACACCTGG 0: 1
1: 0
2: 1
3: 10
4: 198
1076808064_1076808076 7 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808076 10:132869244-132869266 CCAGGCGGCGCAGGGTGGGACGG 0: 1
1: 0
2: 2
3: 46
4: 385
1076808064_1076808071 2 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808071 10:132869239-132869261 AAACCCCAGGCGGCGCAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 245
1076808064_1076808068 -8 Left 1076808064 10:132869214-132869236 CCTGGCCGCACCAAGGGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1076808068 10:132869229-132869251 GGCGAGACTCAAACCCCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076808064 Original CRISPR GTCTCGCCCTTGGTGCGGCC AGG (reversed) Intronic