ID: 1076808124

View in Genome Browser
Species Human (GRCh38)
Location 10:132869625-132869647
Sequence CGCCGTCCGAGGAGAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076808118_1076808124 20 Left 1076808118 10:132869582-132869604 CCTTCACAGATCTCGTGCGAGGC No data
Right 1076808124 10:132869625-132869647 CGCCGTCCGAGGAGAAGAGGAGG No data
1076808115_1076808124 26 Left 1076808115 10:132869576-132869598 CCCGCTCCTTCACAGATCTCGTG No data
Right 1076808124 10:132869625-132869647 CGCCGTCCGAGGAGAAGAGGAGG No data
1076808116_1076808124 25 Left 1076808116 10:132869577-132869599 CCGCTCCTTCACAGATCTCGTGC No data
Right 1076808124 10:132869625-132869647 CGCCGTCCGAGGAGAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076808124 Original CRISPR CGCCGTCCGAGGAGAAGAGG AGG Intronic