ID: 1076808240

View in Genome Browser
Species Human (GRCh38)
Location 10:132870422-132870444
Sequence GTGGAGACAGACTGCAAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076808237_1076808240 16 Left 1076808237 10:132870383-132870405 CCAAAAATGATTCAGTTCAGTGA 0: 1
1: 0
2: 1
3: 26
4: 273
Right 1076808240 10:132870422-132870444 GTGGAGACAGACTGCAAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076808240 Original CRISPR GTGGAGACAGACTGCAAGCT CGG Intronic
No off target data available for this crispr