ID: 1076809698

View in Genome Browser
Species Human (GRCh38)
Location 10:132880086-132880108
Sequence CACACACACGTGCGCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 397}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076809698_1076809701 24 Left 1076809698 10:132880086-132880108 CCTGCTGTGCGCACGTGTGTGTG 0: 1
1: 0
2: 4
3: 45
4: 397
Right 1076809701 10:132880133-132880155 TGTGGAGTGGCCACCCTAGCTGG No data
1076809698_1076809699 6 Left 1076809698 10:132880086-132880108 CCTGCTGTGCGCACGTGTGTGTG 0: 1
1: 0
2: 4
3: 45
4: 397
Right 1076809699 10:132880115-132880137 TGTATGTGTGTGTGTGTGTGTGG 0: 35
1: 4077
2: 6229
3: 10206
4: 18281
1076809698_1076809700 11 Left 1076809698 10:132880086-132880108 CCTGCTGTGCGCACGTGTGTGTG 0: 1
1: 0
2: 4
3: 45
4: 397
Right 1076809700 10:132880120-132880142 GTGTGTGTGTGTGTGTGGAGTGG 0: 75
1: 919
2: 4109
3: 10738
4: 14412
1076809698_1076809702 25 Left 1076809698 10:132880086-132880108 CCTGCTGTGCGCACGTGTGTGTG 0: 1
1: 0
2: 4
3: 45
4: 397
Right 1076809702 10:132880134-132880156 GTGGAGTGGCCACCCTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076809698 Original CRISPR CACACACACGTGCGCACAGC AGG (reversed) Intronic
900122120 1:1053175-1053197 GACACCCACGTGCAGACAGCAGG - Intronic
900161447 1:1225994-1226016 CACACACACGTGAACAGGGCTGG + Intronic
900334756 1:2156908-2156930 CACACACACGTGCACACAACTGG - Intronic
900335301 1:2160227-2160249 CACACACACACGCACACTGCTGG - Intronic
900358731 1:2277634-2277656 CACACACACGTCAGCACTGTGGG + Intronic
900522864 1:3114409-3114431 CGCACACACATGCACACACCAGG + Intronic
901053250 1:6436342-6436364 AACACACACGTTCTCTCAGCTGG - Intronic
901498392 1:9636139-9636161 CATACACACATGGGCACAGTGGG - Intergenic
901668044 1:10837541-10837563 CACACAGCCATGCGCACAGCAGG + Intergenic
902481002 1:16711738-16711760 AACACACACGTTCTCTCAGCTGG + Intergenic
903965563 1:27087059-27087081 CACACACACACACACACAGCAGG + Intergenic
904045837 1:27607641-27607663 CCCAGACACAGGCGCACAGCGGG - Intergenic
904384590 1:30132947-30132969 CACTCACATGTGCACCCAGCAGG - Intergenic
904605094 1:31693805-31693827 CAGACATATGTGGGCACAGCTGG + Intronic
905357101 1:37392255-37392277 GCCACACACGTGCACACACCGGG + Intergenic
906522993 1:46478195-46478217 CACACACACCTGTGCACACACGG - Intergenic
906998152 1:50820469-50820491 CACACACACATGCACACAAAAGG - Intronic
907995515 1:59627493-59627515 CACACACACACACACACAGCTGG + Intronic
911603588 1:99874512-99874534 TGCACACACGTGCACACAGCAGG + Intronic
911660186 1:100492836-100492858 CACACACACACACACACAGCAGG - Intronic
911998518 1:104798923-104798945 CACAGACATGTGTGCACAGAGGG + Intergenic
912377434 1:109222367-109222389 CACACACATGTGTGCAAAACTGG - Intronic
915307000 1:154986015-154986037 CACACACACACACACACAGCCGG - Intronic
915735463 1:158081890-158081912 CACACACCCGGGCACACACCTGG + Intronic
918575731 1:186057050-186057072 CACACACACACACACACAGCTGG + Intronic
919182323 1:194102951-194102973 CACACAGAGTTGAGCACAGCTGG + Intergenic
919886626 1:201939756-201939778 CACACACACACACACACAGCAGG - Intronic
920655070 1:207868764-207868786 CACTCACCCCTGCGCGCAGCTGG + Intergenic
921048560 1:211494460-211494482 CACACACACACACGCAGAGCCGG - Intergenic
922024889 1:221741098-221741120 CACACTCACGCGCGCACACGGGG + Intronic
922118559 1:222638533-222638555 CACACACACACACACACAGCTGG + Intronic
922727416 1:227928993-227929015 CACACACACGTGCACAGCGCCGG - Intronic
922789176 1:228300759-228300781 GACACACACATGCACACAGAGGG - Intronic
1063428424 10:5967116-5967138 CACACACATGTGCACACACAAGG - Intronic
1063531366 10:6834534-6834556 CACACACACACACACACAGCAGG - Intergenic
1063751879 10:8958510-8958532 CACACACACACACACACAGCTGG + Intergenic
1064836669 10:19539846-19539868 CACACACACACGCACAAAGCTGG - Intronic
1064934805 10:20667840-20667862 CACACACACACACACACAGCTGG - Intergenic
1069272900 10:66552407-66552429 AACACACACATGCACACAACAGG + Intronic
1069834924 10:71302353-71302375 CACACACACGCTCGCTCAGGTGG - Exonic
1069997030 10:72348689-72348711 CAAACACAGGAGCTCACAGCTGG + Intronic
1070557924 10:77544146-77544168 CACACACACACACACACAGCTGG - Intronic
1073224345 10:101904335-101904357 CACACACACATTCCCTCAGCAGG + Intronic
1073402364 10:103268782-103268804 CACACACAAATGCACACAGAAGG - Intergenic
1073405576 10:103294272-103294294 CACACACACGCACGCAGAGCTGG + Intergenic
1073597880 10:104818085-104818107 CACACACACCTGTGCACACTTGG + Intronic
1074527028 10:114271626-114271648 CACACACACACACACACAGCAGG + Intronic
1075166947 10:120077156-120077178 CAAACACACGTGCACACACACGG - Intergenic
1075489995 10:122858599-122858621 TACACACCTGTGCCCACAGCAGG + Intronic
1076600472 10:131654021-131654043 CACACACACATGCACACACAAGG + Intergenic
1076809698 10:132880086-132880108 CACACACACGTGCGCACAGCAGG - Intronic
1077119654 11:901007-901029 CACAGGCACGTGCGCCCAACTGG + Intronic
1077369814 11:2176229-2176251 CACACACACATGCACACATGGGG + Intergenic
1077801810 11:5546758-5546780 AACACACACGGGTGCACAGACGG + Intronic
1079128088 11:17732882-17732904 CACACACACACACACACAGCTGG - Intergenic
1079132645 11:17756597-17756619 AACACACAAGTGGGCACAGGAGG + Intronic
1079597776 11:22272329-22272351 CACACACACACACACACAGCTGG + Intronic
1080869757 11:36227088-36227110 CACAAACACCTGCCCACTGCCGG - Exonic
1081428965 11:42955270-42955292 CACACACACAAGCCCACACCTGG + Intergenic
1081645895 11:44790141-44790163 CACACACACATGCACACACGCGG - Intronic
1081994929 11:47357986-47358008 CACACACACCTGCTCACACATGG + Intronic
1082759084 11:57109014-57109036 CACACACACATGCACGCAGAGGG - Intergenic
1083332441 11:61905246-61905268 CACAAGCACGTGCACACAGGAGG + Intronic
1083592988 11:63906127-63906149 CACACACACACACACACAGCGGG - Intronic
1088164714 11:106920160-106920182 CACACACACACGCACACACCAGG + Intronic
1088701709 11:112419046-112419068 CACACACACATGCACACATATGG - Intergenic
1088761448 11:112932754-112932776 CACACCCAAGTTCCCACAGCTGG + Intergenic
1089093915 11:115902182-115902204 CACACACACATATACACAGCAGG + Intergenic
1089203270 11:116738511-116738533 CCCACCCACGTGCACACACCAGG - Intergenic
1089296755 11:117473858-117473880 CACAAGCAAGTGCCCACAGCAGG - Intronic
1089374675 11:117986142-117986164 CACACACACGTACCCACGGCCGG + Intergenic
1090200387 11:124850501-124850523 CACACACACATGCACACACACGG - Intergenic
1091225173 11:133952810-133952832 CACACACACTTCTGGACAGCTGG + Intronic
1092111251 12:5966296-5966318 CACACACGTGTGCACACAACTGG + Intronic
1092759836 12:11799743-11799765 CACACACACGCACACACATCAGG - Intronic
1092997245 12:13962113-13962135 CACACACACGTGCACGAAGCTGG + Intronic
1093236242 12:16611066-16611088 CACACACACTTGCACACACAGGG - Intergenic
1093677530 12:21961359-21961381 CACACACACACACACACAGCTGG + Intergenic
1095050369 12:37548692-37548714 CACACACACGCACACACAGACGG - Intergenic
1095457212 12:42400825-42400847 CACACACACGTGCACGCAAGTGG + Intronic
1095756319 12:45770744-45770766 CACTCAGAGGTGGGCACAGCAGG + Intronic
1096717216 12:53498904-53498926 CACACACACACACACACAGCAGG - Intronic
1097053751 12:56238388-56238410 CACACATAGATGCCCACAGCGGG + Exonic
1097221027 12:57451272-57451294 CACACTTGCGTGCCCACAGCTGG - Intergenic
1101971325 12:109314957-109314979 CAGACACACGTCACCACAGCTGG - Intergenic
1102230568 12:111259027-111259049 CACACACACACACACACAGCTGG - Intronic
1102561191 12:113763304-113763326 CACACACACGTGCACACACACGG - Intergenic
1102866040 12:116374700-116374722 CACACACACACACACACAGCTGG + Intergenic
1103294639 12:119876034-119876056 CACACACAGGTGAGCAAAGTTGG + Intronic
1103476657 12:121223693-121223715 CATACACATGCGTGCACAGCGGG + Intronic
1103593190 12:122006706-122006728 CACACCCAAGGGCGCACAGGTGG - Intergenic
1103629471 12:122248056-122248078 CACACACACACACACACAGCTGG - Intronic
1103931113 12:124451613-124451635 CACACACCCATGCACACAGCAGG + Intronic
1106586177 13:31058279-31058301 CACACACACGTGTGCACACCAGG - Intergenic
1108543972 13:51472417-51472439 CACACACACACACACACAGCTGG - Intergenic
1108592175 13:51921900-51921922 CACACACACACGCACACAGTGGG - Intergenic
1112567736 13:100565753-100565775 CACACAGAAGTCCCCACAGCTGG - Intronic
1113386211 13:109850748-109850770 CACACACACATGCACACAAAGGG - Intergenic
1113595904 13:111532155-111532177 CGCACACACGTGCACAGAGGAGG + Intergenic
1113610677 13:111642742-111642764 CTCACGCACGTGTGCACACCTGG - Intronic
1113740599 13:112710180-112710202 CACACACACGTCTGCAAAGAGGG - Intronic
1113839993 13:113353634-113353656 CACAGAGACAAGCGCACAGCGGG + Intronic
1113874008 13:113583425-113583447 CACACACTCGTGCACACAAGCGG + Intergenic
1113874035 13:113583581-113583603 CCCACACTCGCGCACACAGCCGG + Intergenic
1113874136 13:113584256-113584278 CACACACTCTTGCACACAGCCGG + Intergenic
1113874152 13:113584326-113584348 CACACACTCGTGCACATAGCCGG + Intergenic
1113874161 13:113584368-113584390 CACACACTCTTGCACACAGCCGG + Intergenic
1114382865 14:22226621-22226643 CACACACACATGCACACACACGG - Intergenic
1114724305 14:24918485-24918507 CACACACACACACACACAGCAGG + Intronic
1117095021 14:52288406-52288428 CACACACACGAGGGCATGGCTGG + Intergenic
1117183318 14:53214582-53214604 CACACACACAGCTGCACAGCCGG - Intergenic
1117249665 14:53923769-53923791 CACACACACATGCACACACAAGG + Intergenic
1118024100 14:61751284-61751306 CTCCCACACGTACGCGCAGCGGG - Intergenic
1118054648 14:62067092-62067114 CACACACACATGCACACACACGG - Intronic
1118300809 14:64614333-64614355 CACACACACACACACACAGCAGG - Intergenic
1119657722 14:76429338-76429360 GACACACACTTCAGCACAGCTGG - Intronic
1121274177 14:92656649-92656671 CACACATTCGTGCCCACGGCAGG - Intronic
1121532426 14:94664905-94664927 CACACACACATGTACACACCCGG + Intergenic
1121796348 14:96739060-96739082 CACACACACACACACACAGCCGG - Intergenic
1121992494 14:98573291-98573313 CACACACACGTACACACACAGGG + Intergenic
1122597930 14:102906144-102906166 CACACACACGTGGGGATAGCTGG + Exonic
1122750193 14:103927719-103927741 CACAAACAGGTGCGGACAGGAGG - Intronic
1122796030 14:104206686-104206708 CACACACATGCACACACAGCAGG - Intergenic
1122924629 14:104893977-104893999 CACATACACGTGCACACGGGAGG - Intronic
1123108398 14:105853766-105853788 CACACACACGGGCACACACATGG - Intergenic
1124339909 15:28884380-28884402 CCCACACACGTTCACACAGATGG + Intergenic
1124906133 15:33870267-33870289 CACATACACATGCACAGAGCAGG - Intronic
1125397073 15:39260599-39260621 CACGCACACATGCACACACCAGG - Intergenic
1125444972 15:39744804-39744826 CACACACAGTTCCCCACAGCTGG + Intronic
1125810578 15:42537256-42537278 CACACACACGCACGCACACATGG + Intronic
1127585835 15:60376953-60376975 CACACACACGTGTGTACACACGG + Intronic
1129710821 15:77819587-77819609 CACACCCAGGCGCGCACACCCGG + Intronic
1129727316 15:77908176-77908198 CACACACACATGCGCATGCCGGG - Intergenic
1130073008 15:80664932-80664954 CACACACACACACACACAGCAGG + Intergenic
1130509938 15:84581208-84581230 CACACACACATGCACACAGCAGG - Intergenic
1131614151 15:93996578-93996600 GACAAACACATGTGCACAGCAGG - Intergenic
1131929417 15:97423214-97423236 CACACACACGCACACACAGAAGG + Intergenic
1132006619 15:98233272-98233294 CACACACACACACACACAGCTGG - Intergenic
1132240759 15:100255625-100255647 CACACACACACACACACAGCTGG + Intronic
1132285296 15:100658133-100658155 CACACACACACACACACAGCAGG - Intergenic
1132638896 16:968063-968085 CACACAGACGTGCATACCGCGGG - Intronic
1133345173 16:5065038-5065060 CACACACACAAGCACACAGGTGG - Intronic
1133651923 16:7820621-7820643 CACACACACACGCGCAAAGGGGG + Intergenic
1133769227 16:8858183-8858205 CACACACACAGGAGCACAGCTGG + Intronic
1134680847 16:16124373-16124395 CACACACACACACACACAGCCGG - Intronic
1135176806 16:20237174-20237196 CACACACACATACACACAGAGGG + Intergenic
1135396851 16:22138287-22138309 CACACACACACACACACAGCAGG - Intronic
1135765406 16:25173507-25173529 GACACACACGTGTTCACACCTGG + Intronic
1136791000 16:32968064-32968086 CACACATACGTGCACACACACGG + Intergenic
1136878813 16:33885868-33885890 CACACATACGTGCACACACACGG - Intergenic
1137556775 16:49475210-49475232 CACACACACGAGCACACACCAGG - Intergenic
1137838267 16:51615551-51615573 AACACACACGTGGGCTCAGTAGG - Intergenic
1137992372 16:53171885-53171907 CACACACACACACACACAGCAGG + Intronic
1138761760 16:59552685-59552707 CACACACACGGCTGCGCAGCTGG - Intergenic
1138985839 16:62327662-62327684 CACACACACATACACACAGTGGG + Intergenic
1141602077 16:85133123-85133145 TAGACACACGTGTGCACAGACGG - Intergenic
1142114529 16:88349416-88349438 CACACCCAAGTGCACACACCAGG + Intergenic
1142151304 16:88513634-88513656 CACACACACCTGGCCACACCTGG - Intronic
1142496810 17:310376-310398 CACACACACGCGCCCCCAGCAGG - Intronic
1142958586 17:3537391-3537413 CACACACACGTGTGGACTACAGG + Intronic
1143628801 17:8125534-8125556 CACACCCGGGTGCGAACAGCCGG - Intergenic
1143779044 17:9219825-9219847 CACACACACGTGCACACACACGG - Intronic
1144226571 17:13154961-13154983 CACGCACACATGCCCACATCAGG - Intergenic
1144457771 17:15432972-15432994 CCCACACACATGCTCAGAGCTGG + Intergenic
1145063459 17:19746599-19746621 CACACACACATGCACACGCCTGG - Intronic
1145305659 17:21673692-21673714 CACACACACGCACACACAGACGG + Intergenic
1145370993 17:22305789-22305811 CACACACACGCACACACAGACGG - Intergenic
1145787692 17:27604737-27604759 GACACACACGTGTCCACAGATGG + Intronic
1146974285 17:37097773-37097795 CACACACACTTGCCCACATGTGG + Intronic
1147395614 17:40140413-40140435 CACACACACACACACACAGCGGG + Exonic
1147852637 17:43453711-43453733 CACACGCAGCTGCACACAGCTGG - Intergenic
1147875786 17:43619485-43619507 CACACACACGTATGCACAGGCGG + Intergenic
1148130980 17:45262466-45262488 CACACACACTTGTGCACACAGGG + Intergenic
1149905022 17:60518345-60518367 CACACACACGCACGCACACACGG - Intronic
1150571842 17:66393628-66393650 CACACACACGTGCACACACATGG - Intronic
1150585634 17:66515358-66515380 TACACACACGTGTGCACACATGG - Intronic
1151595379 17:75075224-75075246 CACACACACACACACACAGCCGG + Intergenic
1151997032 17:77616377-77616399 CACACACACCTGTGCAGAGATGG + Intergenic
1152089977 17:78240988-78241010 CAGACAGACACGCGCACAGCTGG - Intergenic
1152090167 17:78242081-78242103 TGGACAGACGTGCGCACAGCTGG - Intergenic
1152161495 17:78671194-78671216 CACACATAGGGGCCCACAGCGGG + Intergenic
1152324135 17:79625850-79625872 CCCACACACGTGCGCAGACGGGG + Intergenic
1152678171 17:81652204-81652226 CACTCACACATGCGCACACACGG - Intronic
1153473770 18:5474453-5474475 CACACACATGTGCACACACAAGG - Intronic
1154052090 18:10970687-10970709 CACACACACACACACACAGCTGG + Intronic
1154078341 18:11228100-11228122 CACACACACACACACACAGCAGG + Intergenic
1154988715 18:21579825-21579847 CACACACACACACACACAGCAGG + Intronic
1155171334 18:23268782-23268804 CGCACACACACACGCACAGCAGG - Intronic
1158635305 18:59150913-59150935 CAGACACACTTGCACACAGAAGG + Intronic
1158890743 18:61869758-61869780 CGCACACACATGCACACACCCGG + Intronic
1160715588 19:575184-575206 CACACACACACGCGCACACACGG - Intronic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161353771 19:3807837-3807859 CACACACACGGGCACACACATGG - Intronic
1161353892 19:3808718-3808740 AACACACACATGCTCCCAGCAGG - Intronic
1161805457 19:6440791-6440813 CACACACTGGTGCCCAGAGCCGG - Exonic
1162367228 19:10256892-10256914 CACACACAGCTGCGCACATCTGG + Intronic
1163778263 19:19230879-19230901 CACACACACACACACACAGCCGG - Intronic
1164147596 19:22521597-22521619 CACACACACACACACACAGCTGG + Intronic
1164159013 19:22614502-22614524 CACACACACACACACACAGCTGG - Intergenic
1164245348 19:23423364-23423386 CACACACACGTGCACATGGTGGG - Intergenic
1164308713 19:24028182-24028204 CACACACACGTGCACATGGTGGG + Intergenic
1164479691 19:28601949-28601971 CACACGCACATGCACACACCTGG + Intergenic
1164510107 19:28889763-28889785 CAGACACACGGGAGCTCAGCCGG - Intergenic
1164683079 19:30149019-30149041 CACACACATGTGCACACAGGCGG + Intergenic
1165128833 19:33619944-33619966 CACACACACATGCACACACACGG - Intergenic
1165142191 19:33706338-33706360 CACACACACATGCACACACATGG - Intronic
1165255605 19:34575942-34575964 CACACACACACACACACAGCAGG - Intergenic
1165900766 19:39168299-39168321 CGCACACACCTGCACACACCTGG - Exonic
1166228155 19:41410196-41410218 CAGACACACATGCCCACTGCAGG - Intronic
1166644490 19:44520832-44520854 CACACACACGCACGCACTCCTGG - Intronic
1167772850 19:51531573-51531595 CCCACTCACCTGCCCACAGCAGG + Exonic
1168046054 19:53795096-53795118 CACACACACACGCACACACCAGG - Intronic
1168390714 19:56005633-56005655 CACACACACACGCGCGCAGGTGG + Intronic
1168658638 19:58148852-58148874 CACACACTTGTACACACAGCAGG - Intronic
1202715039 1_KI270714v1_random:37643-37665 AACACACACGTTCTCTCAGCTGG + Intergenic
925035428 2:681557-681579 CACACACACACACACACAGCTGG - Intergenic
925462380 2:4074601-4074623 CACACACACGGGTTCACAGTAGG - Intergenic
926236456 2:11048803-11048825 CACACACACATGCACACACGTGG - Intergenic
928084727 2:28338912-28338934 CACACACATGCACGCACAGAGGG - Intergenic
928327562 2:30332251-30332273 CACACACACGAGCACACATATGG - Intergenic
929445872 2:42000933-42000955 CACACACACGTGCACGCTGAGGG + Intergenic
930700646 2:54456156-54456178 CACACACACAAGCGCACTCCCGG - Intergenic
930949662 2:57124642-57124664 CACACACATGCACACACAGCAGG - Intergenic
932469208 2:71942938-71942960 CACACACACACACGCACACCAGG - Intergenic
932496732 2:72149287-72149309 CACACACACCTCCGCACACACGG + Intergenic
933455009 2:82508732-82508754 CAGACACAGGTGCCCACAGCAGG + Intergenic
935300102 2:101686518-101686540 CACACGCACGTACACACACCAGG - Intergenic
937131437 2:119517052-119517074 CACACACACATGCACACAAATGG + Intronic
938969310 2:136417608-136417630 CACACACACGTGCTCTCTGAGGG + Intergenic
942124130 2:172806011-172806033 CACACACACACACACACAGCCGG - Intronic
942406670 2:175663250-175663272 CACACACACGTGCACATAGGAGG + Intergenic
942422560 2:175822962-175822984 CACACACACAGGCACACAGAGGG + Intergenic
943447609 2:188007579-188007601 CACACACACACGCTCAGAGCAGG + Intergenic
943698610 2:190964331-190964353 CACACACACATGCACACAAATGG + Exonic
943856241 2:192796085-192796107 CACAGACACATGCGCACACTGGG - Intergenic
946973410 2:225120974-225120996 CACACACACATGCACACACACGG + Intergenic
947101303 2:226624126-226624148 CACACACACATGCACACACATGG - Intergenic
947102739 2:226638876-226638898 CACGCCCACATGCGCACAGAGGG + Intergenic
947788760 2:232849596-232849618 CATACACACATGCTCACACCAGG + Intronic
948121779 2:235536162-235536184 CACACACACACACACACAGCAGG + Intronic
948121796 2:235536260-235536282 CACACACACACACACACAGCAGG + Intronic
948121813 2:235536358-235536380 CACACACACACACACACAGCAGG + Intronic
948121822 2:235536420-235536442 CACACACACACACACACAGCAGG + Intronic
948154636 2:235771380-235771402 CCACCACACGTGGGCACAGCTGG + Intronic
1169625908 20:7568776-7568798 CACACACACACACGCACACCTGG - Intergenic
1170847736 20:19976053-19976075 CACACACACGTTACCACAGCAGG - Intronic
1171317507 20:24208176-24208198 CACACACACGCACGCACACACGG - Intergenic
1171385217 20:24765262-24765284 CACACACACATGCACACACAAGG + Intergenic
1171544876 20:25992209-25992231 CACACACACGCACACACAGACGG - Intergenic
1171939263 20:31308794-31308816 CACACAGACATGAGCACTGCTGG - Intergenic
1172141875 20:32728461-32728483 CACACACACGCACGCACAAGGGG + Intronic
1172149203 20:32778821-32778843 CACACACCTGTGGGCCCAGCTGG + Intronic
1172235803 20:33373210-33373232 CACACACACATGCACACACCTGG - Intronic
1174555079 20:51389158-51389180 CACACACACACGCGTACAGGAGG + Exonic
1175598481 20:60254234-60254256 CACACACACGTGCACACGTATGG + Intergenic
1175667116 20:60870228-60870250 CACACAAACATGCGCACACATGG + Intergenic
1175748197 20:61476375-61476397 CACACACACGTGCACACACACGG - Intronic
1175809484 20:61850085-61850107 CACGCACAAGTGCTCACTGCTGG + Intronic
1175886106 20:62291839-62291861 CACACACACCTGGGGACGGCGGG + Intronic
1175886118 20:62291869-62291891 CACACACACCTGGGGACGGCGGG + Intronic
1175886130 20:62291899-62291921 CACACACACCTGGGGACGGCGGG + Intronic
1175987037 20:62769396-62769418 CACACACAAGTGCTCACACCCGG + Intergenic
1176064020 20:63184945-63184967 CACACACAGGTGCACACACATGG - Intergenic
1176094962 20:63336447-63336469 CGCACACACGTGCACACACAGGG - Intergenic
1176106072 20:63388228-63388250 CACGCACATGTACACACAGCAGG + Intergenic
1176252257 20:64131113-64131135 CGCACACACATGCACACACCTGG - Intergenic
1176424633 21:6540639-6540661 CACAGGGACGTGCGCACGGCTGG - Intergenic
1176918339 21:14653852-14653874 CACACACACACACACACAGCAGG + Intronic
1177985257 21:27966643-27966665 CACACACACACACGCACAGATGG + Intergenic
1179565229 21:42243434-42243456 CACACACACGCGCACACACACGG - Intronic
1179700122 21:43148948-43148970 CACAGGGACGTGCGCACGGCTGG - Intergenic
1179716328 21:43290628-43290650 CTCACACCTGTGCGCACAGTTGG - Intergenic
1179998210 21:44983755-44983777 CACACAGACCTGAGCACAGCAGG - Intergenic
1180140021 21:45887602-45887624 AACACCAACGTGTGCACAGCTGG - Intronic
1180785341 22:18543959-18543981 CACACACCCCCGCACACAGCAGG - Intergenic
1181128923 22:20718000-20718022 CACACACCCCCGCACACAGCAGG - Intronic
1181242245 22:21483312-21483334 CACACACCCCCGCCCACAGCAGG - Intergenic
1182108771 22:27707890-27707912 CATATACACGTGCACACACCTGG - Intergenic
1182239425 22:28903239-28903261 CAGACACACACACGCACAGCTGG + Intronic
1183218432 22:36496269-36496291 CACACACACATGCTCACCCCCGG - Intronic
1183250671 22:36728123-36728145 CACACACACATGCACACACATGG - Intergenic
1184162125 22:42703053-42703075 CACACACACACACACACAGCAGG - Intronic
1184521098 22:44994665-44994687 CACACACAGCTGAGCCCAGCTGG + Intronic
1184739656 22:46420481-46420503 CACTCACACGTGTGCACACGTGG + Intronic
1184757351 22:46524530-46524552 CACACACACACGCACACAACGGG - Intronic
1185033226 22:48456735-48456757 GACACACACGAGCCCACAACCGG + Intergenic
949108428 3:228486-228508 CACACACACACACACACAGCAGG + Intronic
950539197 3:13599854-13599876 CACATGCACATGCCCACAGCTGG - Intronic
950611099 3:14127118-14127140 CACACACACGCACACACAGACGG - Intronic
951717541 3:25664901-25664923 CACACACACATTTGCACACCGGG + Intronic
953909413 3:46884111-46884133 CACACACACATGCACACGTCTGG + Intronic
954202459 3:49032135-49032157 TACACACACATGCGCACACATGG + Intronic
954574461 3:51668061-51668083 CACACACACACACACACAGCTGG - Exonic
958973078 3:100635032-100635054 CACACACACGTGCGCGCGCATGG + Intronic
959123361 3:102259754-102259776 CACACACACACACACACAGCAGG - Intronic
960382034 3:116974667-116974689 CACACACACACACGCACAACGGG - Intronic
960497701 3:118394925-118394947 CACACACTGGTGCCCAGAGCCGG - Intergenic
961434422 3:126906777-126906799 CAAACAGACTTGAGCACAGCAGG - Intronic
962318858 3:134374897-134374919 CACACACACACACACACAGCCGG - Intronic
962350547 3:134652653-134652675 CACACGCGCGCGCGCACACCTGG + Intronic
962808407 3:138942930-138942952 CAAACAGACATGCACACAGCAGG + Intergenic
963877679 3:150494795-150494817 CACGCACACGTGCACACAGTAGG + Intergenic
964236313 3:154534370-154534392 CACACACACTTGCACACAGGTGG + Intergenic
966185084 3:177220065-177220087 CACACACACATACACACAGGAGG + Intergenic
967539855 3:190654417-190654439 CACACACTCGTACACACAGAAGG + Intronic
968088115 3:195883301-195883323 CACACTCACCTGCCCAGAGCGGG + Exonic
969155421 4:5205690-5205712 CACACACACGCGCGCGCGCCTGG - Intronic
969457379 4:7307827-7307849 CACACACTCATGCACACACCAGG - Intronic
969706067 4:8792497-8792519 CACACACACATACACACAGAGGG + Intergenic
970580518 4:17470621-17470643 CACTCACACATGCGCAAACCTGG - Intronic
970741427 4:19242408-19242430 CATACACACTTGCACCCAGCTGG + Intergenic
971160372 4:24127542-24127564 CACACACACGTGCGCGCGTGTGG + Intergenic
978768030 4:112424776-112424798 CACACACACGCACGCACACAAGG + Intronic
981343003 4:143644165-143644187 CACACACACATATGCAGAGCAGG - Intronic
985292570 4:188402038-188402060 CACAGACACAGGAGCACAGCAGG - Intergenic
985685231 5:1278393-1278415 CACACACACATGCACACCACAGG + Intronic
986034365 5:3924057-3924079 CCCACACACATGAACACAGCCGG - Intergenic
986155080 5:5166282-5166304 CACACACACATGCACACACACGG + Intronic
986441740 5:7788690-7788712 CACACACACATGCACACAGATGG - Intronic
987476036 5:18393536-18393558 CTCACACAGGTGCTCACAGTGGG - Intergenic
987481725 5:18467481-18467503 CACACACACACGCACACACCTGG - Intergenic
989141908 5:38209876-38209898 CACAAACTGGTGAGCACAGCAGG + Intergenic
991490180 5:67175009-67175031 CACACACACATACACACAGTAGG - Intergenic
991502888 5:67294698-67294720 CACACACACATACACACAGAGGG - Intergenic
991984034 5:72264618-72264640 CACACACATGTGCACACAGAGGG + Intronic
993520766 5:88896954-88896976 CACACACACACACGCACAACTGG + Intronic
994153595 5:96477311-96477333 CACACACACACACACACAGCTGG + Intergenic
994260871 5:97657036-97657058 CACACACACACACACACAGCTGG + Intergenic
994849073 5:105030276-105030298 CACACACATGTGCACACAGGTGG - Intergenic
995485105 5:112632396-112632418 CACCCACACCTGCACACAGAGGG - Intergenic
995869708 5:116731736-116731758 CACACACACATGCACACATCTGG - Intergenic
996349575 5:122523577-122523599 CACACACACATACACAAAGCTGG - Intergenic
997233426 5:132259133-132259155 CACACACACACACACACAGCAGG - Intronic
998150662 5:139755631-139755653 CACACACACACACACACAGCAGG - Intergenic
998342357 5:141429197-141429219 CACACACACGTGTGAAAAGTGGG + Intronic
998656549 5:144187451-144187473 CACACACACATACACACAGGGGG + Intronic
999520694 5:152348080-152348102 CACACACACGTGCGCGCGCGCGG + Intergenic
999902641 5:156101898-156101920 CACACACACACACACACAGCTGG - Intronic
1001381849 5:171310745-171310767 CACACACACGCGCACACACACGG + Intronic
1001545749 5:172569678-172569700 CACCCACACATGCACACAGGGGG + Intergenic
1002584414 5:180233058-180233080 CACACACACACACACACAGCTGG + Intergenic
1004084286 6:12429435-12429457 CACACACACAGGCACACAGAAGG - Intergenic
1005164560 6:22904765-22904787 CAGCCACACGAGCTCACAGCAGG + Intergenic
1006295416 6:33167948-33167970 CACACACACGTGCATACACAGGG + Intronic
1006373301 6:33658478-33658500 CACACAAACGTGCACACAACAGG - Intronic
1006444087 6:34069197-34069219 CACACACACGCACGCACACACGG + Intronic
1006880093 6:37331766-37331788 CACACACACATGCAGACACCTGG - Exonic
1007120920 6:39380558-39380580 CACACACACACGCACACACCCGG + Intronic
1007510382 6:42370206-42370228 CATACACACATACACACAGCAGG + Intronic
1007738431 6:43996428-43996450 CACACACACACACACACAGCTGG - Intergenic
1010249757 6:73695674-73695696 CACGCACACGCGCGCAAAACCGG - Intergenic
1011959226 6:93066823-93066845 CACACACACACACACACAGCAGG - Intergenic
1013534863 6:111054704-111054726 CACACACACACACACACAGCAGG + Intergenic
1013836732 6:114342927-114342949 CACACACACGCGCACACAGCTGG - Exonic
1015209821 6:130684386-130684408 CACACACACATGCACACACATGG - Intergenic
1016306603 6:142691133-142691155 CACACACACATACGCACACCTGG + Intergenic
1016368847 6:143349730-143349752 CACACACACATGCACACACAAGG - Intergenic
1016398511 6:143652796-143652818 CACACACACATGACCAGAGCAGG - Intronic
1016601099 6:145861790-145861812 CACACACACATACACACAGTGGG + Intergenic
1016939865 6:149474840-149474862 CACACACCCGACCGCACACCAGG + Intronic
1017683577 6:156888422-156888444 CACACACATGTTAGAACAGCAGG - Intronic
1018148773 6:160919278-160919300 CACACACACACACACACAGCTGG - Intergenic
1018928207 6:168221889-168221911 CAGACACATGTGTGCACTGCAGG - Intergenic
1019508254 7:1404451-1404473 CACACACACATGCACACACAGGG + Intergenic
1019593801 7:1849153-1849175 CACACACACGTACGCACATGCGG + Exonic
1019601751 7:1887203-1887225 CACACACACATGCTCACAGTTGG - Intronic
1019741935 7:2679386-2679408 CACACGCACGAGCGCACACGTGG - Intergenic
1019918371 7:4147913-4147935 CACAGACACGGTCTCACAGCAGG + Intronic
1020116394 7:5478693-5478715 CACACACACATGCACACACAGGG + Intronic
1021467520 7:20962287-20962309 CACACACACATGCACACACGGGG + Intergenic
1021485893 7:21168230-21168252 CACACACACGTGCACACGTAGGG - Intergenic
1022093179 7:27121209-27121231 CACACACACACGCACACAGTGGG - Intronic
1023177357 7:37447794-37447816 CAAACACACGCGCGCACCCCCGG + Intronic
1023256212 7:38315037-38315059 CACACACACATACACACATCTGG - Intergenic
1024973898 7:55095737-55095759 CACACAGACATACGCACAGATGG + Intronic
1025296276 7:57777274-57777296 CACACACACGCACACACAGACGG - Intergenic
1026828329 7:73597181-73597203 CTCACACAGCTGCTCACAGCAGG - Exonic
1029302705 7:99598053-99598075 CACACACCCGTGAGCGAAGCCGG + Intronic
1029425321 7:100490741-100490763 TGCACACACCTGTGCACAGCGGG + Intronic
1029683122 7:102126173-102126195 CACACACACACACACACAGCCGG - Intronic
1030908888 7:115221913-115221935 CACACACACTCATGCACAGCAGG + Intergenic
1031968834 7:128048922-128048944 CAAACACCCGTGTGAACAGCTGG - Intronic
1032087883 7:128893229-128893251 CACACACACCTGGGCAGAGCTGG + Exonic
1032373021 7:131378857-131378879 CACACACACGCACGCAAAGCTGG + Intronic
1032992414 7:137408545-137408567 CACACACACGAACACACATCTGG + Intronic
1034313738 7:150111397-150111419 TACACACACGTGTGCACACAGGG - Intergenic
1034793161 7:153989399-153989421 TACACACACGTGTGCACACAGGG + Intronic
1035298515 7:157881353-157881375 CAGACACAGGTGCACACAGAGGG + Intronic
1035718958 8:1776523-1776545 CACACACACGTGATGACAGAAGG + Intronic
1035721749 8:1798018-1798040 CACACACACACACGCACACCCGG - Intergenic
1035736665 8:1892627-1892649 CACACACACATGCACACACACGG - Intronic
1036240514 8:7076817-7076839 CACACACACCTACACACAGAAGG + Intergenic
1036721456 8:11179491-11179513 CACACACACATGTGCATATCAGG - Intronic
1038251384 8:25908178-25908200 CACACACAGCTGCCCACAGCAGG - Intronic
1039648586 8:39315194-39315216 CACACACACACACGCACAGTTGG - Intergenic
1039840553 8:41290148-41290170 AACACACATGTGTGCACAGCAGG + Intronic
1040009391 8:42648694-42648716 CACACACACCTGCACAAAACAGG + Intergenic
1041078926 8:54196025-54196047 CACACACACACACACACAGCTGG - Intergenic
1042055008 8:64755153-64755175 CACACACATATGCACACACCTGG - Intronic
1042115083 8:65422571-65422593 GAGACACAGGTGCACACAGCAGG + Intergenic
1042435518 8:68760176-68760198 CACCCACAGGTCAGCACAGCTGG + Intronic
1042849485 8:73202505-73202527 CACACACACGAACGCACATAAGG - Intergenic
1043041346 8:75265810-75265832 CACACAAACGTGTGGACATCAGG + Intergenic
1043614472 8:82108547-82108569 CACACACACACACACACAGCAGG + Intergenic
1044555522 8:93558268-93558290 CACACACACACACACACAGCAGG + Intergenic
1045977107 8:108141700-108141722 TCCACACACGTGCACGCAGCTGG + Intergenic
1047040971 8:120995303-120995325 CACACACACACACACACAGCAGG - Intergenic
1047405351 8:124581170-124581192 CACACACCACTGCGCCCAGCAGG - Intronic
1048047624 8:130787897-130787919 CACACACACATGCACACATGTGG - Intronic
1049424045 8:142530004-142530026 CGCTCACACATACGCACAGCAGG - Intronic
1050222439 9:3408627-3408649 CACACACACGCACGCACACATGG + Intronic
1051139202 9:13960202-13960224 CACACACACACACGCACATCTGG - Intergenic
1053836003 9:42136452-42136474 CACACACACACACACACAGCCGG - Intergenic
1054336937 9:63816161-63816183 GACACACACGGGCGCACACGCGG - Intergenic
1054594616 9:67052076-67052098 CACACACACACACACACAGCCGG + Intergenic
1055689483 9:78813997-78814019 CACACACACGTGCACACACACGG + Intergenic
1056035279 9:82598201-82598223 CACACACACATGCACACAGAGGG - Intergenic
1056253028 9:84770185-84770207 CACACACACAAACACACAGCTGG + Intronic
1056439048 9:86602245-86602267 CACACACACATGCACACAATTGG - Intergenic
1057843616 9:98505410-98505432 CACACACACCTGGATACAGCTGG - Intronic
1058322822 9:103656130-103656152 CACACACACGCACACACAACGGG + Intergenic
1060149443 9:121278922-121278944 CACACACACATTCACAGAGCCGG - Intronic
1060731766 9:126041907-126041929 CTCCCACATGTGCCCACAGCAGG - Intergenic
1060792018 9:126492125-126492147 CACACACACACACGCTCAGCAGG + Intronic
1061094914 9:128450973-128450995 CACACACGAGTGCTTACAGCAGG + Intergenic
1061708154 9:132468802-132468824 CACACACACGCACGCACACACGG + Intronic
1062136537 9:134931580-134931602 CACACACACAGGCACACACCTGG - Intergenic
1062160532 9:135077159-135077181 CACACACACATGCACACACAGGG + Intronic
1062177169 9:135169892-135169914 CACACACATGTGCTCACACATGG - Intergenic
1062301930 9:135878432-135878454 CAAATGCACCTGCGCACAGCAGG + Intronic
1062729189 9:138099494-138099516 CACAGACACGTGCACACCACAGG - Intronic
1062731383 9:138112141-138112163 GACACACACGTGTGCACATGAGG + Intronic
1185545169 X:937805-937827 CACACACACTTGAGCCCAGGAGG + Intergenic
1185642379 X:1595719-1595741 CACACACTCGGGCGCACATAGGG - Intronic
1186028506 X:5340906-5340928 CACACACACATACACACAGCTGG - Intergenic
1186918687 X:14252499-14252521 CACACACACGTACACACTGGAGG + Intergenic
1189054143 X:37680823-37680845 CACACACACTCGCACACAGAGGG - Intronic
1189217586 X:39340013-39340035 CACACAAACATGCACACACCTGG - Intergenic
1189688962 X:43595449-43595471 TACACACACGCACACACAGCGGG + Intergenic
1194036478 X:88879937-88879959 CACACACATGTGCACACACACGG - Intergenic
1197922599 X:131610917-131610939 CACACACACATGCACACAAAAGG - Intergenic
1198441509 X:136667861-136667883 CACACACATATGCACACAGCGGG + Exonic
1198662142 X:138981348-138981370 CACACACACATGCGAACACAAGG + Intronic
1199303028 X:146234677-146234699 CACACACACGTACGTACACACGG + Intergenic
1200697642 Y:6375185-6375207 CACACACACATGCACACAAAAGG + Intergenic
1201036470 Y:9789514-9789536 CACACACACATGCACACAAAAGG - Intergenic
1201231424 Y:11868434-11868456 GACACACACATGCACACAGAGGG + Intergenic