ID: 1076812832

View in Genome Browser
Species Human (GRCh38)
Location 10:132898207-132898229
Sequence CTCCCTGCTGGGAGATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076812832_1076812838 3 Left 1076812832 10:132898207-132898229 CCTCCCCATCTCCCAGCAGGGAG 0: 1
1: 0
2: 7
3: 54
4: 535
Right 1076812838 10:132898233-132898255 CATCCACAGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076812832 Original CRISPR CTCCCTGCTGGGAGATGGGG AGG (reversed) Intronic
900118659 1:1039396-1039418 CACCCTCCTTGGAGATGGGGGGG + Intronic
900243973 1:1629366-1629388 CTCCCTGCAGGGGGAGGAGGCGG - Exonic
900548032 1:3239404-3239426 CTCACTGCTGGGAGACTGTGGGG - Intronic
900583753 1:3422656-3422678 CTCCTTTCTGGGAGATTGTGTGG + Intronic
901464578 1:9413128-9413150 CTCCCTGCTGGGTCAGGGTGAGG - Intergenic
901530071 1:9847101-9847123 CTCTCTGCTGGGGGCTGGGCAGG + Intergenic
902154405 1:14472537-14472559 TACCCTCCTGGAAGATGGGGTGG - Intergenic
902372310 1:16014349-16014371 CTTCCAGCTGGGGGATGGGGGGG - Exonic
902409683 1:16205661-16205683 CTCCAGGCTGGAAAATGGGGAGG + Exonic
902878931 1:19358167-19358189 CTCCAGCCTGGGAGATGGTGAGG - Intronic
903214039 1:21833376-21833398 CTCTCTGCTGGCAGAGCGGGTGG - Exonic
903348465 1:22703029-22703051 CTTCCTCCTGGGAGCTGGGAGGG - Intergenic
903450837 1:23452668-23452690 CTCCATGCTGGGAGTGGTGGTGG - Intronic
903503224 1:23813662-23813684 CTCCCTGCTGGGCTATTGTGAGG + Intronic
903808163 1:26020113-26020135 CTCCCTGTTGGGAGCTGGAATGG + Intronic
904831567 1:33309356-33309378 CCCCCGTCTGGGAGGTGGGGGGG - Intronic
904972544 1:34430382-34430404 CTCCCTGATGGGGGCTGCGGGGG + Intergenic
905257611 1:36694927-36694949 CCCCATGCTGGGAGCTGGCGGGG + Intergenic
906149938 1:43581755-43581777 CTCTCTGCTGGGAGATGGGACGG - Intronic
906693827 1:47810918-47810940 CTCCCTGGCAGGAGATGGGCAGG - Intronic
907388346 1:54140104-54140126 CTCCTGGATGGGGGATGGGGAGG + Exonic
908248134 1:62243936-62243958 TTCCCTGCTGGTTGATGTGGTGG + Intronic
909902960 1:81160863-81160885 GCCACTGCTGGGGGATGGGGAGG - Intergenic
910758907 1:90717034-90717056 CTCCGAACAGGGAGATGGGGTGG + Exonic
911040794 1:93589170-93589192 CACTCTGCTGGGAGATGGGCCGG + Exonic
911175466 1:94813086-94813108 CTCTCTGCTGGGGGGTGGGGGGG + Intergenic
912706833 1:111920888-111920910 CTCCCTGCTGGGGCCAGGGGAGG - Intronic
913667233 1:121059359-121059381 CCCACTGCTGGGGGCTGGGGTGG + Intergenic
913961963 1:143346448-143346470 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
914018923 1:143846510-143846532 CCCACTGCTGGGGGCTGGGGTGG + Intergenic
914056318 1:144172022-144172044 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
914122828 1:144794340-144794362 CTCCCTGGAGGGAGCTTGGGTGG - Intergenic
914657475 1:149754714-149754736 CCCACTGCTGGGGGCTGGGGTGG + Intergenic
915731957 1:158060184-158060206 CTCCCTGCTGGGAAAGGCGAAGG - Intronic
915830806 1:159128121-159128143 CACTGTGCTGAGAGATGGGGAGG - Intronic
916047193 1:161008928-161008950 CTTCCTGGTGGGAGAGAGGGAGG - Intronic
917932041 1:179829169-179829191 CTCCAAGCGGGGAGATGAGGTGG + Intergenic
917971348 1:180210092-180210114 CTCCCTGATGGGAGATGGAGGGG - Intergenic
918542744 1:185649310-185649332 CTGCTTGCTGGGAGGTGTGGAGG - Intergenic
919118647 1:193312676-193312698 CCGCCTGCTGGGAGAGGAGGAGG + Intergenic
919924038 1:202183109-202183131 CTACCTGGTGGGAGGTGGAGAGG - Intergenic
920065536 1:203266795-203266817 GCCCCTTCTGGGAGATGGGGGGG - Intronic
921185674 1:212667438-212667460 CTTCCTGGTGGGGGAAGGGGAGG + Intergenic
921381969 1:214533319-214533341 CTGCCTGCTGGAAGACGGTGAGG + Intronic
921414167 1:214869589-214869611 CGTCCTGGAGGGAGATGGGGGGG - Intergenic
921675694 1:217973824-217973846 ACCCCTGCTGGAAGATGGTGTGG - Intergenic
922035835 1:221846928-221846950 CTACCTTCTGGGAGAGGGGAGGG + Intergenic
922143809 1:222918097-222918119 CTCCCTGTTGGGAAATGAGAAGG + Intronic
922166181 1:223117318-223117340 CTGCTTGCTGGGAGGTGTGGAGG - Intronic
922851114 1:228735168-228735190 CACCCTCTTGGGAGCTGGGGAGG + Exonic
923506914 1:234611940-234611962 CTCCCAGCTTGGAGAGGGTGAGG - Intergenic
924243033 1:242057921-242057943 CTCCCTGCAGGGAGCTGAGTGGG + Intergenic
924548076 1:245049015-245049037 CTCCCATCTGGGTGATGGAGTGG - Intronic
924588514 1:245380889-245380911 CTCCTCCCTGGGAGGTGGGGAGG + Intronic
1065023437 10:21518969-21518991 TTCTCTGCTGGGGGGTGGGGTGG + Exonic
1067558614 10:47289156-47289178 GTCCCAGCTGGGAGATGCAGCGG + Intergenic
1067669602 10:48306922-48306944 CCCCCTCCTGGGAGTGGGGGCGG + Intronic
1068505341 10:57893268-57893290 CTCAAAGCTGGGGGATGGGGTGG + Intergenic
1068910447 10:62374133-62374155 CTCCCGGCTGGGTGGCGGGGGGG + Intergenic
1069090855 10:64197154-64197176 CTGCTTGCAGGGAGGTGGGGAGG - Intergenic
1069890419 10:71648942-71648964 GGCCCTGCAGGGAGATGGTGGGG + Intronic
1069920268 10:71811936-71811958 TTCCCTGCAGGGAGAAGGGTTGG - Exonic
1070332827 10:75430567-75430589 CTCCCAGCTGAGAGAGGGGCAGG + Intergenic
1071523238 10:86343926-86343948 TCACCTGCTGGGAGCTGGGGTGG + Intronic
1071749447 10:88458127-88458149 AACCCAGATGGGAGATGGGGTGG - Intronic
1072462191 10:95630115-95630137 GACCCTGTTGGGAGAGGGGGGGG - Intronic
1072696464 10:97607328-97607350 CACCCAGCTGGGAGCGGGGGTGG + Intronic
1072804716 10:98417263-98417285 CTTTATCCTGGGAGATGGGGAGG - Exonic
1073074020 10:100812150-100812172 TTCCCTGATGGAAGGTGGGGAGG - Intronic
1073178418 10:101570107-101570129 CTCCCGGCGGGGTGACGGGGAGG + Intergenic
1075399544 10:122151120-122151142 ATCACTGCTGGGAGTTGGAGTGG - Intronic
1075704050 10:124488345-124488367 GTCCCTGGTAGGAGATGGGGAGG + Intronic
1075906850 10:126089051-126089073 CTGCCAACTGGGAGTTGGGGCGG - Intronic
1076628211 10:131834606-131834628 GGCCTTGCTGGGTGATGGGGAGG + Intergenic
1076662673 10:132065750-132065772 CGCCCTGCAGGGAGCTGGGCTGG + Intergenic
1076701973 10:132278008-132278030 CTCCCTGGAGGGAACTGGGGAGG - Intronic
1076812832 10:132898207-132898229 CTCCCTGCTGGGAGATGGGGAGG - Intronic
1076979601 11:197500-197522 CTCCCAGCGGGGAGAAGGGCAGG + Intronic
1077405016 11:2378926-2378948 CTCTCAGCTGGGAGATGAGTGGG + Intronic
1078595232 11:12680712-12680734 ATCCCTACTGGGATAGGGGGAGG + Intronic
1079115565 11:17638572-17638594 CTCCCCGCTGGGAGATCCAGTGG + Intronic
1080840551 11:35979757-35979779 CTCCGTGTTGAGAGATGTGGTGG + Intronic
1081558724 11:44192253-44192275 CTCCCTACCTGGAGATGAGGAGG - Intronic
1081679739 11:44993796-44993818 CTCACTGCTAGGAGCCGGGGAGG - Intergenic
1081835305 11:46148866-46148888 CTCAGTGATGGGTGATGGGGTGG + Intergenic
1081870604 11:46381197-46381219 CGCCCTGCTGGCTGCTGGGGAGG - Intronic
1083528949 11:63398684-63398706 GCCACTGCTGGGAGATGGGCAGG + Intronic
1083717395 11:64585540-64585562 CATCCTGCTGAGAGGTGGGGTGG - Intergenic
1083746704 11:64741115-64741137 CAGCCTGCTGGGTGATGGTGGGG - Intronic
1083890114 11:65591784-65591806 CTCCATGCTGGAAGGTGGCGGGG - Exonic
1084001972 11:66300769-66300791 TCTCCTGATGGGAGATGGGGTGG + Intergenic
1084760186 11:71265992-71266014 CTCCCTGCTGGGGGCAGGGGTGG + Intergenic
1085409302 11:76281985-76282007 CAGGCTGCAGGGAGATGGGGAGG - Intergenic
1085743816 11:79098224-79098246 CACTGAGCTGGGAGATGGGGGGG - Intronic
1085791414 11:79500226-79500248 ACCCCTTCTGGGAGGTGGGGGGG + Intergenic
1088750037 11:112835655-112835677 TTCACTGCGGGGAGTTGGGGCGG + Intergenic
1088936230 11:114402897-114402919 TTACCTGCTAGGAGATGTGGAGG - Exonic
1089330891 11:117688311-117688333 CCCACTGCTTGGAGATGGGAGGG - Intronic
1089698643 11:120230956-120230978 AGCCTTGCTGGGGGATGGGGAGG + Intergenic
1090165047 11:124537646-124537668 GTCCCTTCAGGGAGATGGTGAGG + Intergenic
1090232104 11:125114720-125114742 CCGCCTGCTGGAAGATGGGGAGG + Intergenic
1090477440 11:127036435-127036457 CTCTCATCTGGGAGGTGGGGTGG - Intergenic
1092477155 12:8829007-8829029 GTCACTGCTGGGGGATGGCGGGG + Intronic
1092765534 12:11849749-11849771 CTTCTTTCTGGGAGAAGGGGAGG + Intronic
1092839737 12:12528303-12528325 CTACCTACTGGGAGAGGGGCCGG + Intronic
1093998912 12:25673717-25673739 CTCCCTTTGGAGAGATGGGGAGG + Intergenic
1095102983 12:38202431-38202453 CTCCCTGCAGGGAGCTGAGCTGG + Intergenic
1095912485 12:47442834-47442856 CCACCTGCTGGAAGATGAGGAGG + Intergenic
1096182658 12:49559184-49559206 CTTCCTGCTGGGGCAGGGGGTGG + Intronic
1096478087 12:51920916-51920938 CTGCCTGCAGGGGGCTGGGGGGG + Exonic
1096634967 12:52952313-52952335 CCGCCTGCTGGAAGATGGCGAGG + Exonic
1097246169 12:57608963-57608985 CTCCCTTAGGGGAGGTGGGGAGG + Intronic
1097248506 12:57619820-57619842 CTGGCTGCTCGGAGATGCGGTGG + Intronic
1097261910 12:57725246-57725268 CTGCCTCCAAGGAGATGGGGGGG + Intronic
1098060970 12:66561982-66562004 CTACCTGGTGGGGGATGTGGGGG + Intronic
1099222755 12:79934565-79934587 CTCCCTGCTGCGGGGTGAGGGGG - Intronic
1099437286 12:82659599-82659621 CTGCTTGCTGGGAGGTGTGGAGG - Intergenic
1101291762 12:103377591-103377613 CTCCCAGCTCGGGGATGAGGTGG - Intronic
1101468892 12:104976876-104976898 CCGCCTGCTGGAAGATGGCGAGG - Intergenic
1102009942 12:109612047-109612069 CTCCCTGGTGGGAATTAGGGGGG + Intergenic
1102046983 12:109835555-109835577 CTCCATGGTGGGGGTTGGGGTGG + Intergenic
1102323442 12:111957680-111957702 GTCCCGTCTGGGAGGTGGGGGGG + Intronic
1102377409 12:112433924-112433946 CTCCAGGCTGGGAGATAGAGTGG + Intronic
1104108428 12:125684866-125684888 CTCCCTTCTTGGAGGAGGGGAGG + Intergenic
1104487846 12:129167259-129167281 CCACCTGCTGCGAGATGGTGAGG - Intronic
1104646892 12:130504032-130504054 ATCCATGCTGGGAGCAGGGGGGG + Intronic
1105810842 13:23993789-23993811 CTGCCTGCTGTGAGCAGGGGTGG - Intronic
1105817671 13:24051624-24051646 CTCCCTGTTTGGGGATGGAGGGG + Intronic
1105883445 13:24623335-24623357 CTGCTTGCGGGGAGATGTGGAGG + Intergenic
1106468310 13:30032716-30032738 TTCTCTGCTGGCAGGTGGGGCGG - Intergenic
1108686693 13:52826251-52826273 CTGCTTGCTGGGAGGTGTGGAGG + Intergenic
1109741492 13:66561043-66561065 CAGCTTGCTGGGAGATGTGGAGG + Intronic
1110369999 13:74729182-74729204 CTCCTTGCAGGGAGGTGGAGTGG + Intergenic
1111993182 13:95137113-95137135 CTTCTGGCTGGGAGCTGGGGTGG - Intronic
1112030331 13:95450706-95450728 CTCCCTCCAGGGAGAATGGGAGG - Intronic
1112464225 13:99629473-99629495 CTCCCTGCTGTGGGGTTGGGTGG + Intronic
1114234664 14:20813544-20813566 CTTCCTGCTGGGAATTGTGGTGG + Intergenic
1114924945 14:27384336-27384358 CTGCCTGCTGGGGTATGGGGGGG + Intergenic
1115472837 14:33785991-33786013 CTCCCTGCTGTGGGGTGGTGGGG - Intronic
1116368786 14:44104152-44104174 ATCCCCGCTGGGAGATGAGGTGG - Intergenic
1116962216 14:50978139-50978161 CTCCTTGCAGGGAGAAGGGCAGG + Intronic
1117000421 14:51365922-51365944 CACCGGGCTTGGAGATGGGGCGG - Intergenic
1117009306 14:51454061-51454083 CTCCCTGCTGGCTGCTGGCGGGG - Intergenic
1117162403 14:53002238-53002260 CTGACTGCTGGGAGATGAGAAGG - Intergenic
1117600945 14:57373808-57373830 CTACATGCTGGGAGTGGGGGAGG - Intergenic
1117742583 14:58833907-58833929 CTGCTTGCTGGGAGGTGTGGAGG + Intergenic
1117960124 14:61154199-61154221 CTCCCTGCTGGGTGGTGGGTTGG + Intergenic
1118729142 14:68654558-68654580 CCACATCCTGGGAGATGGGGCGG - Intronic
1119731909 14:76956527-76956549 CTTCCTGCAGGGAGGCGGGGTGG - Intergenic
1119780831 14:77275897-77275919 CTACCTACTGGGTGGTGGGGAGG - Exonic
1120053087 14:79891394-79891416 CTCCATGCCTGGAAATGGGGAGG - Intergenic
1120215782 14:81679555-81679577 CAGCCTGCAGGGAGGTGGGGAGG - Intergenic
1120680249 14:87472217-87472239 CTCTCTGCTGGGCCATGGGTTGG + Intergenic
1120746040 14:88152924-88152946 CTGCCTGCTAAGAAATGGGGTGG + Intergenic
1121210387 14:92203973-92203995 CTCCCTGTTGGGGGAGGTGGGGG + Intergenic
1121422313 14:93824464-93824486 CTGCCTCCAGGGAGATGTGGGGG + Intergenic
1121614568 14:95304534-95304556 CACCCAGCTGGGAGATGTGGGGG - Intronic
1122082348 14:99274485-99274507 CTTCCTGCTGGGAGTGGGGAGGG - Intergenic
1122409127 14:101517142-101517164 TCCACTGCTGGGAGTTGGGGAGG + Intergenic
1122540204 14:102493738-102493760 CTCCCTGCTGTGACAGGGGCAGG + Intronic
1122561939 14:102621972-102621994 CTCTTTGCGGGGAGAGGGGGAGG - Intronic
1123134135 14:106011861-106011883 CTCCCTGCAGGGAGGCGGAGGGG - Intergenic
1123147063 14:106142225-106142247 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1123168523 14:106349222-106349244 CTCCCTGCAGGGAGGCGGAGGGG - Intergenic
1123218211 14:106831670-106831692 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1123696592 15:22883320-22883342 CATCCTGCTGGGAGACTGGGAGG - Intronic
1124158990 15:27252369-27252391 CGTCCTGCTTAGAGATGGGGAGG - Intronic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124375085 15:29124632-29124654 GCGCCTGCTGGGAGGTGGGGCGG - Intronic
1127867555 15:63044020-63044042 CTCCCAGCTGGAAGATGAGCTGG + Exonic
1128547594 15:68578715-68578737 CTGCCGGCTGGGAGAACGGGCGG - Intergenic
1129867643 15:78921699-78921721 CTCCCTCCTGGGAGACTGAGTGG + Exonic
1131003993 15:88960903-88960925 CTGCCTGCTGGAAGACAGGGAGG + Intergenic
1131514007 15:93065675-93065697 CTCTCTGCTGGAAGTAGGGGTGG + Intronic
1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG + Intergenic
1131919089 15:97303342-97303364 CTCCTGGATGGGAAATGGGGTGG - Intergenic
1132157266 15:99504394-99504416 TTCACTGTGGGGAGATGGGGGGG + Intergenic
1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG + Intergenic
1132553127 16:561313-561335 GTCCCTGCTGGGAGGCGGGATGG + Intronic
1133221238 16:4319998-4320020 GCCCCTGCTGGGGGATGGGTGGG + Intronic
1133284329 16:4683620-4683642 CCCCATGCTGGGGGATGGGAAGG + Intronic
1133739084 16:8638224-8638246 CTCCCTGCTTGCAGAAGGGAGGG - Intronic
1135381018 16:21996263-21996285 CACCCTGCAGGCAGATGGGCAGG + Intronic
1136367071 16:29813789-29813811 CTGCCAACTGGGAGCTGGGGTGG - Exonic
1136397813 16:30002650-30002672 CTCCCTCCCTGGAGATGGGAGGG + Intronic
1137295637 16:47090541-47090563 CTCACTGCTGGGTCATGGTGTGG + Intronic
1137303960 16:47181385-47181407 CGTCCGGCAGGGAGATGGGGGGG + Intronic
1138514810 16:57530240-57530262 CCCAGTGCTGGGCGATGGGGAGG - Intronic
1138561832 16:57805589-57805611 GTCCCTGCCTGGGGATGGGGTGG - Intronic
1138578527 16:57924210-57924232 CTCTCTGCTGGGACAGAGGGTGG - Intronic
1139243883 16:65421759-65421781 CACCCTCCTGGGAGGAGGGGAGG - Intergenic
1139355977 16:66367219-66367241 CTCTATGCTGGGATCTGGGGAGG + Intronic
1139578451 16:67857338-67857360 CTCCCTGCAGGCAGAAGAGGAGG + Intronic
1140182055 16:72729755-72729777 CTGCCTGCTGGAAGATGGCGAGG + Intergenic
1140265095 16:73413554-73413576 CTCTATGCTGGGGGCTGGGGTGG + Intergenic
1140962889 16:79933886-79933908 CTCCTTGCAGAGAAATGGGGTGG - Intergenic
1141166764 16:81666071-81666093 CTCCCCACTGGGGGATGGGGCGG + Intronic
1141380105 16:83568640-83568662 CTCCTTGCTGGTAGATGGGAAGG + Intronic
1141536340 16:84683350-84683372 CAGCCTCCTGGGAGAAGGGGAGG - Intergenic
1142065687 16:88061027-88061049 CGCCCTGCTGGAAGGGGGGGTGG + Intronic
1142482581 17:227996-228018 GTCCCTGCTGGGACAGGGGACGG + Intronic
1143987801 17:10930123-10930145 CACCTGGCCGGGAGATGGGGAGG + Intergenic
1144149250 17:12427626-12427648 CTCCCTGCTGTATAATGGGGGGG + Intergenic
1144711277 17:17403325-17403347 CTCCCTGATGGGTTGTGGGGAGG + Intergenic
1144890464 17:18491204-18491226 CCCTCTGGTGGGAGCTGGGGTGG + Intronic
1145141753 17:20453114-20453136 CCCTCTGGTGGGAGCTGGGGTGG - Intronic
1147137795 17:38444141-38444163 CTCCTTTGTAGGAGATGGGGAGG + Intronic
1147387822 17:40092171-40092193 CTCCCTGCTCAGACTTGGGGAGG + Intronic
1147951819 17:44111709-44111731 CTCTCTGCTGGTTGAAGGGGTGG - Intronic
1147979814 17:44267672-44267694 CTCCTAGGTGGGAGAGGGGGTGG + Intronic
1147982396 17:44282584-44282606 CTTCCTGCTGGGATTAGGGGTGG - Intergenic
1147986613 17:44310690-44310712 CTCCCTGATAGGAGATGCAGTGG - Intronic
1148018315 17:44537975-44537997 CTCCTGGCTGGGAGTGGGGGTGG + Intergenic
1148680988 17:49473352-49473374 CATCCAGCTGGGAGATGGGGGGG + Intronic
1149781792 17:59403435-59403457 TTCCCTGCTGGGAGAAAGGGAGG + Intergenic
1149909003 17:60551682-60551704 CGTCCTGGAGGGAGATGGGGGGG + Intergenic
1150330724 17:64292299-64292321 GTCCCTGGTGGGAGAGGGGGGGG + Intergenic
1150426286 17:65079601-65079623 CTCCTCGCTGGGAAGTGGGGGGG - Intergenic
1150486275 17:65546072-65546094 TGCCCTGCTGGGAGCTGGGGAGG - Intronic
1150808399 17:68337108-68337130 TTCTCTGCTGGGATGTGGGGTGG + Intronic
1151160295 17:72159325-72159347 CTTTCTGATGGGGGATGGGGAGG - Intergenic
1151319081 17:73342094-73342116 ATTCCTGCTGGGAGTCGGGGTGG - Intronic
1151341274 17:73472449-73472471 TTCCCTGCTTGGAGAAGGGCAGG - Intronic
1151414489 17:73952649-73952671 CTCCCAGGTGGCGGATGGGGCGG - Intergenic
1151450293 17:74194598-74194620 CTCAATGCTGGGGGATGGGGAGG - Intergenic
1151495021 17:74453922-74453944 GACCCGGCTGGGAGAGGGGGCGG + Intergenic
1151591425 17:75047185-75047207 CTCCCTGCCGAGAAATGGGCCGG + Intronic
1152404145 17:80086972-80086994 TACCATGCTGTGAGATGGGGAGG + Intronic
1152656418 17:81521484-81521506 CTGGCTGCTGGGGGATGGAGAGG - Intronic
1152703930 17:81833255-81833277 CTCCCAGCTGGAAGAGGCGGTGG - Intronic
1203161874 17_GL000205v2_random:60112-60134 CCGCCTGCTAGAAGATGGGGAGG - Intergenic
1153907777 18:9678371-9678393 CTGCCTGCTGGAAGATGGTAAGG - Intergenic
1155504703 18:26521805-26521827 CTGCCGGCTGGGACATGGGAGGG + Intronic
1156032549 18:32729216-32729238 TTGCCTGTAGGGAGATGGGGAGG + Intronic
1157088340 18:44605254-44605276 CGCCCCTCTGGGAAATGGGGTGG - Intergenic
1157261737 18:46181252-46181274 CTCCCTCTCGGGAGGTGGGGGGG + Intronic
1157520390 18:48341499-48341521 CTCGCTGATGGGTGATGGGGTGG - Intronic
1158590225 18:58772835-58772857 CTCCCTTCTGAGAGAGGAGGTGG - Intergenic
1160024029 18:75204401-75204423 GGCTCTGCTGGGAGCTGGGGCGG + Intronic
1160145049 18:76356891-76356913 CTCACTGCTGGGTGATCAGGAGG + Intergenic
1160413822 18:78693587-78693609 CTCCATGCTGGGACATGCTGGGG - Intergenic
1161048254 19:2148607-2148629 CTCCTTGCTGGATGATGCGGAGG - Intronic
1161132957 19:2602449-2602471 CTCCCTTCAGGGCGCTGGGGAGG + Intronic
1161316804 19:3621070-3621092 CCTCCTGTTGGGAGTTGGGGCGG - Intronic
1161725312 19:5925152-5925174 GTCCCGACTGGGAGATGGGCGGG - Intronic
1161817838 19:6510747-6510769 CTCACTGCTAGGCAATGGGGTGG - Intergenic
1161865231 19:6828361-6828383 CTCCCCGCAGGGAGAAGGGGAGG + Intronic
1161906360 19:7159778-7159800 CTCCTTTTTGGGAGAAGGGGCGG - Intronic
1162180327 19:8864424-8864446 CTCCCAGTTGGGGGGTGGGGTGG + Intronic
1163273577 19:16268766-16268788 TTTCCTGCTGGGAGAAGCGGAGG - Intergenic
1163427541 19:17247405-17247427 ATCCCTGCTGGGAGAGAGGAAGG + Intronic
1163591184 19:18194939-18194961 CTGCCTGCGGGGAGAGGCGGGGG - Exonic
1163633184 19:18427268-18427290 CGCCCTCCTGAGAGATGGAGGGG + Intronic
1163987062 19:20963220-20963242 CCGCCTGCTGGAAGATGGCGAGG + Intergenic
1164619984 19:29689652-29689674 TCCCCTGATGGGAGAGGGGGTGG + Intergenic
1165869991 19:38964845-38964867 CTCCCGGATGCCAGATGGGGAGG - Intronic
1165890028 19:39106359-39106381 CTCCCTGATGGGCGTTGGGATGG + Intronic
1166561388 19:43734441-43734463 CTCGTGGCTGGGGGATGGGGTGG + Exonic
1166881718 19:45934172-45934194 CTCCCTCTTGGAATATGGGGAGG - Exonic
1166888544 19:45975542-45975564 CTCCCTCCAGGAAGATGGAGGGG - Intergenic
1166965698 19:46528383-46528405 GTCTCAGCTGGGTGATGGGGTGG - Intronic
1167593297 19:50415705-50415727 CATCCTGCGTGGAGATGGGGTGG - Exonic
1167601797 19:50459092-50459114 TTCCCTGCGGGGAGAGGGCGGGG - Exonic
1167808753 19:51809923-51809945 CCCCCTGCTGGGAAATGAGATGG - Intronic
1168242526 19:55094613-55094635 CTCCCTGCTGGGGGCGGGGGCGG + Intronic
1168615580 19:57834376-57834398 GGCACTGCTGGGGGATGGGGAGG + Intronic
1168621204 19:57881071-57881093 GGCACTGCTGGGGGATGGGGAGG - Intronic
1202695800 1_KI270712v1_random:124709-124731 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
925341772 2:3142839-3142861 CTCCCTGCTCCCAGGTGGGGTGG + Intergenic
925341793 2:3142909-3142931 CTCCCTGCTCCCAGGTGGGGTGG + Intergenic
925384635 2:3453526-3453548 CTCCCTGCTGGAAGCTGCTGAGG - Intronic
925976588 2:9146243-9146265 CTCCTTGCTGGGAGTGGGGCAGG + Intergenic
926298876 2:11588327-11588349 CTCCCTGCTTGGAGTCAGGGAGG + Intronic
926321272 2:11749729-11749751 CTCCCAGCTGAGAGGTTGGGAGG + Intronic
926344222 2:11930823-11930845 CTTCCTGCTTGGAGGTGGGTTGG + Intergenic
927435342 2:23061490-23061512 CTCCTTGCTGGGAGGTGGCAGGG - Intergenic
928082262 2:28321822-28321844 CTCACTGCTTGGAGAGGAGGAGG + Intronic
931406856 2:61987909-61987931 CTCCTGCCTGGGAGAAGGGGAGG - Intronic
932092189 2:68816222-68816244 CTCCTTGCTGGCACATGGGCAGG + Intronic
932499209 2:72167513-72167535 CTTTCTGCAGGGAGATGAGGGGG - Intergenic
932608001 2:73177156-73177178 CTTCCTCCTGGGAGGAGGGGCGG + Intergenic
932703313 2:74005020-74005042 CTCTCTGCTGGGAGAAAGGACGG + Intronic
932743062 2:74306853-74306875 CTGCCTGCTGGAAGATGGCAAGG - Intronic
932893160 2:75613214-75613236 CTCTGTGCTGGGAACTGGGGCGG + Intergenic
933129400 2:78654741-78654763 CTCTTGGCTGGGGGATGGGGGGG - Intergenic
933371922 2:81425277-81425299 CTCTCTGCTTGGGGATGGAGAGG - Intergenic
933531596 2:83518148-83518170 CTGCTTGCTGGGAGGTGTGGAGG + Intergenic
933773110 2:85756035-85756057 CTTCCTGCTGGGGGTTGGGGTGG + Intronic
934276963 2:91581747-91581769 CTCCCTGGAGGGAGCTTGGGTGG + Intergenic
934513172 2:94964478-94964500 CTCCCTGCAGGGAGACAGGAGGG - Intergenic
935535371 2:104287063-104287085 CTCCCTGCTGGGTTGTGGGTTGG - Intergenic
935976869 2:108586844-108586866 GTCCCTGCTGGGAATGGGGGAGG + Intronic
937126139 2:119476177-119476199 CTTCCTGCCGGGAGATGAAGGGG + Intronic
937239865 2:120453089-120453111 CTGCCTGCTGGGATAGGGGCTGG + Intergenic
937307392 2:120880916-120880938 CTCCCTGGTGGGGGCAGGGGGGG - Intronic
938371060 2:130768547-130768569 CACCCTGCTGGGGGATGGAGGGG + Intergenic
939186978 2:138872339-138872361 CTCCCGTCTGGGAGGTGGGGGGG - Intergenic
939416226 2:141901256-141901278 CTCATTGCTGGGAGATTGAGTGG - Intronic
939912926 2:148005392-148005414 GGGCCTGCTGGGGGATGGGGGGG + Intronic
941125772 2:161581200-161581222 CTGCCTGCTGGAATATGGGGAGG + Intronic
941324132 2:164091854-164091876 CTCAATGCTGGCAGGTGGGGAGG - Intergenic
942510067 2:176688555-176688577 CTCCCTGATGGTAGAGGGGCAGG + Intergenic
943548580 2:189311388-189311410 CCGCCTGCTGGAAGATGGTGAGG - Intergenic
944158645 2:196636196-196636218 CCCACTGCTGTCAGATGGGGTGG + Intergenic
944715702 2:202375099-202375121 CTGCCTGGTAGGAGATGGGAAGG + Intergenic
944855628 2:203764422-203764444 CCGCCTGCTGGAAGATGGCGAGG - Intergenic
944899065 2:204196046-204196068 CTCCCAGCTGTGAGGTGGGCTGG + Intergenic
946002763 2:216496581-216496603 GTGGCTGCTGGGAGGTGGGGAGG + Intergenic
946078985 2:217100117-217100139 CACTGTGCTTGGAGATGGGGTGG + Intergenic
946404601 2:219485521-219485543 CTCCCTGATGGGGGTAGGGGAGG - Intronic
946411649 2:219518136-219518158 CTCCCTGCTCAGAGCTGTGGAGG + Intronic
947354495 2:229277763-229277785 CTCACTGCTGGGAGGTGGTAGGG + Intergenic
947668491 2:231922400-231922422 CAAGCTGCTGGGAGAAGGGGAGG - Intronic
1168851570 20:980563-980585 CTCGCAGCTGGGACTTGGGGAGG + Intronic
1169630272 20:7622828-7622850 CTGCTTGCTGGGAGGTGTGGAGG - Intergenic
1170462431 20:16589776-16589798 CTGCCTGCTGGGAGGTGTGCAGG + Intergenic
1170568953 20:17622220-17622242 GTCCCTGCTGGGAGATGTCCCGG - Intronic
1171139997 20:22732927-22732949 CCGCCTGCTGGAAGATGGCGAGG - Intergenic
1172083415 20:32359231-32359253 CTTCCTGGTGGGTAATGGGGTGG + Intronic
1172120112 20:32593387-32593409 CTCCCTGGTGGGACATGGGGAGG + Intronic
1172174259 20:32962520-32962542 CACTCTGCTGGGAGGTTGGGAGG + Intergenic
1172781329 20:37438508-37438530 CTCCCTGCTCTGGGCTGGGGAGG - Intergenic
1172853402 20:37982850-37982872 CTGACGGCTGGGAAATGGGGAGG + Intergenic
1173743367 20:45418427-45418449 GTCCCTCCTGGGAGATGGCTAGG - Intronic
1174533866 20:51236128-51236150 CTCCATGCTGGGAGTTGTGAGGG + Intergenic
1175267771 20:57712962-57712984 CTCACTGCTGGGAGTGGGAGTGG + Intergenic
1175428702 20:58888573-58888595 CTCCCAGGTGGGAGAGGTGGCGG - Intronic
1175521238 20:59604059-59604081 CTCCCTGCCGGGGGGCGGGGGGG - Intronic
1175549122 20:59805352-59805374 CACCCTGCTAGGACATGGGCGGG + Intronic
1175622999 20:60466561-60466583 GTACCTGCTGGGAGATGAGAGGG + Intergenic
1175877312 20:62236540-62236562 CTCCCTGCTTGGCCCTGGGGTGG + Intronic
1176215162 20:63944455-63944477 CTCCCTGGGGCGGGATGGGGGGG + Exonic
1176238325 20:64064433-64064455 CTGCCTCCTGGGGGGTGGGGAGG + Intronic
1176240795 20:64074989-64075011 CTCCCCTGGGGGAGATGGGGTGG + Intronic
1176241224 20:64076808-64076830 CTCCCCTGGGGGAGATGGGGTGG - Intronic
1177387292 21:20425077-20425099 CCCCCTGCTGGAAGATGGTGAGG - Intergenic
1177581009 21:23021721-23021743 CTCCCTGCTAGCAGAGGGAGCGG + Intergenic
1178021341 21:28411971-28411993 CTTACTGTTGGGAGATGGTGGGG - Intergenic
1178536612 21:33415042-33415064 ATCCTTGCTGGGAGCTGTGGGGG + Intronic
1179065920 21:38024855-38024877 CTCCCTGAAGGGAGACGGTGTGG - Intronic
1179264983 21:39795344-39795366 GTCCGTGCTTGGAGCTGGGGTGG - Intronic
1179994568 21:44967998-44968020 CCCCCTGCTGAGAGCTGGGGTGG + Intronic
1180006733 21:45026127-45026149 CTCCCTGCGGGGAGCTGTGCTGG + Intergenic
1180038172 21:45261382-45261404 CTCCCAGCTGGGAGATGTGAAGG - Intergenic
1180887662 22:19258656-19258678 CCGCCTGCTGGAAGATGGGGAGG + Intronic
1181082495 22:20424475-20424497 CTCCCCGCTGAGATAAGGGGTGG + Intergenic
1181092396 22:20482943-20482965 CCGCCTGCTGGAAGATGGCGAGG - Intronic
1181105407 22:20571672-20571694 CCCCCTGCTGGGGGATGGGGAGG + Intronic
1181438124 22:22922099-22922121 GTCTCTGCAGGGAGGTGGGGTGG + Intergenic
1181478082 22:23180795-23180817 CTCCCTGGTGGCAGGTGAGGCGG - Exonic
1181589905 22:23877627-23877649 CTCCCTGCAGGGAGGTGTGTAGG + Intronic
1181592642 22:23894631-23894653 TTCCGCGCTGGGAGCTGGGGAGG + Exonic
1182074086 22:27483172-27483194 CTCCTGGCTTGGAGATGGAGAGG + Intergenic
1182147304 22:28004456-28004478 GTCCAGGCTGGGAGATAGGGAGG + Intronic
1182440870 22:30363044-30363066 GCCCCTGCTGGCAGGTGGGGAGG + Intronic
1182751957 22:32648906-32648928 CTCCCTGCAGGGAGTTTGGATGG + Intronic
1182917043 22:34043628-34043650 CCCCTGCCTGGGAGATGGGGAGG + Intergenic
1183324480 22:37183989-37184011 CAGCCTGCTGGGAGGTGGGTAGG - Intronic
1183371317 22:37434041-37434063 CTCCCTCCAGGGAGATGCTGGGG + Intergenic
1183469054 22:37996207-37996229 CTGCCTGCTGGGGGAAGGGGTGG - Intronic
1183541320 22:38430967-38430989 CTCCCTGCAGGGGGCTGGAGTGG + Intronic
1183726072 22:39590339-39590361 CTACCTGCAGGAAGAAGGGGAGG - Intronic
1183951507 22:41355450-41355472 CACCCTGTGGGGGGATGGGGAGG - Exonic
1184004137 22:41696579-41696601 CTTCCTGCTGGTGGGTGGGGAGG + Exonic
1184648103 22:45907018-45907040 CTCCGGGCTGGGAGAGGGGTGGG + Intergenic
1184768892 22:46586700-46586722 GTCCCTGCTGGGACATGAGTTGG + Intronic
1185270906 22:49929035-49929057 GTCCCGGCTGGAAGATGGGGCGG - Intergenic
1185284301 22:49993486-49993508 CTCCGTGTTGGGTGCTGGGGCGG + Intergenic
949140382 3:626157-626179 GTCACTGCTGGATGATGGGGTGG + Intergenic
949341785 3:3038412-3038434 CGCCCTGCTCAGAGCTGGGGTGG - Intronic
950069828 3:10142918-10142940 CTGCCTGCTGGGAGATGGAGGGG + Intronic
950204893 3:11071605-11071627 CTCCTTGCGGGGAGGTGTGGAGG - Intergenic
950403249 3:12787517-12787539 CCGCCTGCTGGAAGATGGCGAGG - Intergenic
950425864 3:12924464-12924486 CTACTTGCTGGGACATGTGGTGG - Intronic
950442367 3:13017691-13017713 CTCGATGCAGGGAGAGGGGGCGG + Intronic
950561920 3:13735839-13735861 GTCCCTGCTGGGAGACATGGGGG + Intergenic
950778263 3:15369075-15369097 CTGCCTGCTGAAAGATGAGGAGG + Intergenic
950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG + Intronic
951024903 3:17818067-17818089 CAGCCTGCTGGGAGGTGTGGAGG - Intronic
951495180 3:23317447-23317469 GTCTCTGCTGGTGGATGGGGAGG + Intronic
952652171 3:35739502-35739524 GGACCTGCTGGGAGATGGGAGGG - Exonic
952861045 3:37812431-37812453 CACCCTGCAGGGGGCTGGGGAGG + Intronic
954198055 3:49007866-49007888 CTCCCTTCTAGGAGATGGGCGGG + Intronic
954334764 3:49909765-49909787 CCCTCTGCTGGGGGAGGGGGTGG + Intronic
954389581 3:50261584-50261606 CTACCTGCTGGGACAGGGGGTGG - Intergenic
955069955 3:55564147-55564169 TTCCCTGCTGAGCAATGGGGTGG + Intronic
955527817 3:59839021-59839043 CGCCCAGCTGGGAGATGAGATGG - Intronic
955896685 3:63707819-63707841 CTCCCTGCTTGAAGCTGAGGAGG - Intergenic
956129288 3:66038951-66038973 CTCCCTTCGGGGAGGAGGGGAGG - Intergenic
956137606 3:66114571-66114593 CTCCAGGCTGGGCGATGGAGGGG - Intergenic
956459180 3:69454416-69454438 CTGCTTGCTGGGAGGTGTGGAGG + Intronic
956710218 3:72032570-72032592 CTCTCTGGTGGGAGGTGGTGTGG + Intergenic
957845144 3:85722092-85722114 CTCTCTGCTGAGAGCTGCGGAGG - Intronic
958024763 3:88037848-88037870 CTTCCTTCTGGAGGATGGGGAGG - Intergenic
958078220 3:88711826-88711848 GTCCCTGCAGGGTGAGGGGGAGG - Intergenic
960479499 3:118171375-118171397 CTGCTTGCTGGGAGGTGTGGAGG + Intergenic
961390621 3:126550499-126550521 GTAGCTGCTGGGAGATGGGCTGG - Intronic
961451014 3:127002327-127002349 CTGTCGGCTGGGAGAGGGGGAGG - Intronic
961477288 3:127156818-127156840 CACCCTTGTGGGAAATGGGGAGG - Intergenic
961650042 3:128412767-128412789 TTGGCTGCTGGGAGTTGGGGCGG + Intergenic
961682510 3:128608478-128608500 CTCCCGGCTGGCAGAGGGGCCGG - Intergenic
961736624 3:129005726-129005748 CTCACAGCTGGGAGATGGTAAGG + Intronic
961741902 3:129038410-129038432 CACCCAGCTGGGAGGTGGAGGGG - Intronic
962009749 3:131381684-131381706 ATCCCTGCAGGGATAAGGGGAGG - Intronic
962123373 3:132587961-132587983 ATCACTGCTGGGAAATGAGGTGG - Intronic
962919251 3:139935913-139935935 CTCCCAGCTCGGGGATGGAGTGG + Intronic
966808941 3:183826680-183826702 CTGCCTGCTGGGACATGGCCTGG - Intergenic
966885884 3:184377991-184378013 CTCCCAGCTGGGGGAGGGGCAGG - Intronic
967234145 3:187367951-187367973 CAGCCTGCTGGGAGATGTGGAGG - Intergenic
967448939 3:189600206-189600228 ATCACTGTTGGGAGAGGGGGTGG + Intergenic
968162458 3:196438149-196438171 CTCCAGCCTGGGAGATGGAGTGG + Intergenic
968613507 4:1567457-1567479 GTCCCTGGTGGGGGATGGCGGGG - Intergenic
968688193 4:1975527-1975549 TTCCCTGCTGTGGGCTGGGGAGG + Intronic
968948907 4:3680146-3680168 CTCCCTGCTTGGAGGTGGGCTGG + Intergenic
968961385 4:3746011-3746033 CTTCCTGCAGGGAGTGGGGGAGG + Intergenic
969033802 4:4234640-4234662 CTCCCTGGAGGGAGCTTGGGTGG - Intergenic
969175381 4:5394995-5395017 CTCCTTTCTGGAACATGGGGTGG + Intronic
969660585 4:8525273-8525295 AACCCCGCTGGGAGAAGGGGTGG + Intergenic
970082351 4:12301835-12301857 CTTCCTGGTGGGTGAGGGGGTGG + Intergenic
971079858 4:23197111-23197133 ATCCCCGCTGGGAGATGTGTGGG + Intergenic
971374902 4:26048790-26048812 CTCCCTGGTGAGTAATGGGGAGG + Intergenic
973671896 4:53228176-53228198 CTCAATGGTGGTAGATGGGGTGG + Intronic
973930853 4:55791910-55791932 CTGCCTGCTGGGAGATGCCCAGG - Intergenic
974838268 4:67275625-67275647 CTGCCTGCAGGGAGGTGTGGAGG - Intergenic
977097555 4:92765775-92765797 CTCTGTGCTGGGAGTTGAGGTGG - Intronic
977348786 4:95853190-95853212 CTTCCTTCTGGGTGATGGGCTGG + Intergenic
978176697 4:105740374-105740396 ATCCCTGCTGGGGAATGGGCGGG + Intronic
979630873 4:122901175-122901197 CTCCCTGCTTTGAGTTGGTGAGG + Intronic
980442842 4:132870467-132870489 ACCACTGCTGGGAGAAGGGGAGG - Intergenic
981170274 4:141615488-141615510 CTGCTTGCTGGGAGGTGTGGAGG + Intergenic
981866060 4:149420466-149420488 AGGCCTGCTGGGAGGTGGGGTGG + Intergenic
982350356 4:154408759-154408781 ATCCCAACTGGGTGATGGGGTGG - Intronic
984767363 4:183409858-183409880 TCCTCTGATGGGAGATGGGGTGG + Intergenic
985192024 4:187384737-187384759 GTGCTTGCTGGGAGTTGGGGTGG + Intergenic
985663921 5:1172091-1172113 CAGGCTGCTGGGGGATGGGGTGG - Intergenic
985769054 5:1797625-1797647 CTCCTTTCTGGGAGAAGGGGAGG + Intergenic
985867502 5:2525340-2525362 CTCTCTGCTAGGGGTTGGGGTGG - Intergenic
986547908 5:8918789-8918811 CTCACTGCTGGGATGTGAGGAGG + Intergenic
986547918 5:8918857-8918879 CTCACTGCTGGGGTATGAGGAGG + Intergenic
986963555 5:13244183-13244205 CTGCTTGCAGGGAGATGTGGAGG + Intergenic
987049106 5:14134818-14134840 CTCCCTGCTGGACCCTGGGGAGG - Intergenic
987525639 5:19045741-19045763 CCCACTGCTGGGAGATGAGAGGG + Intergenic
987872801 5:23642425-23642447 GTTCCTGTTGGGAGGTGGGGGGG - Intergenic
988020560 5:25614937-25614959 CTGCTTGCTGGGAGGTGTGGAGG - Intergenic
988500090 5:31777081-31777103 CTGCTTGCTGGGAGGTGTGGAGG + Intronic
988605233 5:32673472-32673494 CTTCCTGCAGGGAGGTGTGGAGG - Intergenic
990512192 5:56499037-56499059 CTGCTTGCTGGGAGGTGTGGAGG - Intergenic
991291159 5:65035085-65035107 CCCGCTGCTGGGAGGTGGCGGGG - Intergenic
992557256 5:77915950-77915972 CTGCCTGCTGAGAGTTGGGGAGG + Intergenic
992578792 5:78149871-78149893 CTCTCCGCTGAGAGATGGGGTGG + Intronic
992800290 5:80289554-80289576 CCACCTGCTGGAAGATGAGGAGG + Intergenic
993902938 5:93596601-93596623 CCCACTGCGGGGAGATGGGGTGG - Intergenic
996452145 5:123637255-123637277 CAGCCTGCTGGAAGATGGCGAGG + Intergenic
997589163 5:135062431-135062453 CTCCCTGCTGGGGTAGGGAGAGG + Intronic
998152242 5:139764195-139764217 CTGCGGGCTGCGAGATGGGGAGG + Intergenic
998262514 5:140642244-140642266 CTGCGTGTGGGGAGATGGGGAGG - Intronic
998771576 5:145551892-145551914 CTCCCTGCTGGGCTGTGGGTTGG - Intronic
998786363 5:145714119-145714141 CATCTTGCTGGGAGTTGGGGAGG - Intronic
998855861 5:146394675-146394697 CTCCCTGGTGGTGGATGGGAAGG - Intergenic
999246188 5:150155938-150155960 GGCCCAGCTGGGAGAAGGGGGGG + Intergenic
999272148 5:150302816-150302838 CTCCCTGCAGGGAGGTGGGCAGG + Exonic
1001250136 5:170140787-170140809 CTGCCTGCTGGAAGACGGTGAGG - Intergenic
1001328372 5:170745525-170745547 CTCCCTGCTGGGCGTGGGCGAGG - Intergenic
1001771874 5:174302922-174302944 GCCCCTGCGGAGAGATGGGGTGG - Intergenic
1002277601 5:178113896-178113918 CTCCCGTCTGAGAGATGGGCGGG + Intronic
1003424046 6:5984787-5984809 CTCCCTGCCAGGAGGTGAGGAGG + Intergenic
1003788697 6:9517227-9517249 CTCACTGCTGGGTGATTGGCAGG - Intergenic
1003901552 6:10659865-10659887 CAGCCTGCTGGGAGGTGTGGAGG + Intergenic
1005043542 6:21620681-21620703 AAGCCTGCAGGGAGATGGGGGGG + Intergenic
1005374283 6:25166175-25166197 GTTCTTGCTGGGGGATGGGGAGG - Intergenic
1005688625 6:28280251-28280273 TTCCCTGATGGGATATGGTGTGG - Intronic
1005761130 6:28969259-28969281 CCGCCTGCTGGAAGATGGCGAGG - Intergenic
1006358479 6:33574283-33574305 CTTCCAGCTGGGAGAGGGGTGGG - Intronic
1006402785 6:33827409-33827431 CTCTCCGCTGAGAGATGGTGGGG + Intergenic
1006522669 6:34581116-34581138 CTTCCTTCTGGGTGAGGGGGAGG - Intergenic
1006814375 6:36840262-36840284 CTCCATCCTGGGGGAGGGGGAGG + Intergenic
1006863201 6:37187370-37187392 GGCCCTGCTGGGAGATGAGAGGG - Intergenic
1006919198 6:37616330-37616352 CTACCTGCCTGGAGATGGGCAGG - Intergenic
1007782058 6:44260072-44260094 CTCCCTGCTGCGGAATGTGGAGG - Exonic
1010935748 6:81859244-81859266 CTCCCAGCTGGGAGAGGCCGGGG - Intergenic
1011242689 6:85288859-85288881 CCGCCTGCTGGAAGATGGTGAGG + Intergenic
1012168852 6:95992199-95992221 CTGCCTGCTGGAAGATGGGAGGG + Intergenic
1012598819 6:101070242-101070264 CTGCTTGCTGGGAGGTGTGGAGG + Intergenic
1013072187 6:106739466-106739488 CCCCCTGCTGGGTATTGGGGGGG - Intergenic
1013167186 6:107604799-107604821 CTGCCTGCTGAGAGATTCGGAGG - Intronic
1013609788 6:111783781-111783803 CGCCCAGCTGGGAGTGGGGGCGG + Intronic
1014009159 6:116457450-116457472 ATGCCTGCTGGAAGATGGCGAGG - Intergenic
1014517887 6:122401141-122401163 CTCCCTGCTTGGAGTTGAGTAGG + Intronic
1017383557 6:153857300-153857322 CTGCCTGCCGGGAGGTGTGGAGG - Intergenic
1017960028 6:159213488-159213510 GTCCCTGCTGGGCCCTGGGGAGG - Intronic
1018773356 6:166991947-166991969 CTCCCACCTGGGAGATAGAGTGG - Intergenic
1018785975 6:167108348-167108370 CTCCCTGGTGGCAGGTGAGGAGG - Intergenic
1018840441 6:167512720-167512742 GTCCCAGCTGGCACATGGGGTGG + Intergenic
1018853941 6:167662457-167662479 CTCCCAGCCGGGACTTGGGGAGG + Intergenic
1018977654 6:168577646-168577668 ATCACTGCTGGGAGATGCTGCGG - Intronic
1019548933 7:1592671-1592693 GTCCCTGCAGGGAAAGGGGGCGG - Intergenic
1019713073 7:2526179-2526201 CCATCTGCTGGGAGCTGGGGAGG - Intronic
1022009089 7:26292982-26293004 CCCCCTCCTGGGAGAGGAGGGGG - Intronic
1022536568 7:31102218-31102240 AGCTGTGCTGGGAGATGGGGAGG + Intronic
1023039600 7:36160658-36160680 CTGACTGCTGGGAGGTGGTGGGG + Intronic
1023185109 7:37524941-37524963 CTGCCTGCTGGGATGTGGGGAGG + Intergenic
1023716123 7:43046244-43046266 GCCACTGCTGGGGGATGGGGAGG - Intergenic
1023838834 7:44084183-44084205 ATCCCTGCTGGCACAAGGGGAGG - Intergenic
1023867327 7:44244419-44244441 CCCACCGCTGGGAGATGGTGAGG - Intronic
1023882477 7:44328120-44328142 CTCCCAGGTGGCAGCTGGGGAGG + Intronic
1023920632 7:44626814-44626836 CTCCCTGCTTGTAGAGGGGAGGG + Intronic
1024087902 7:45911885-45911907 CTCTCTGATTGGAGATGGGAAGG + Intergenic
1024934361 7:54698020-54698042 CAGCCTCCTGGGAGATGGGGAGG + Intergenic
1025212127 7:57025809-57025831 CTCCCTGCAGGGAGGTGGGTGGG + Intergenic
1025659827 7:63551019-63551041 CTCCCTGCAGGGAGGTGGGTGGG - Intergenic
1026570039 7:71521365-71521387 CTTCCTGCTGGGAAAGGAGGTGG - Intronic
1026847632 7:73706672-73706694 CTCACTGCTGGCAGGTGGGGCGG - Intronic
1027826086 7:83118488-83118510 CTCACTGCTGGGGGATGGGGTGG - Intronic
1029022800 7:97383080-97383102 CTCTCTGCTGGGACATAGGCAGG + Intergenic
1029596252 7:101538926-101538948 ATCCCTGCTGGGAACTTGGGTGG - Intronic
1033215856 7:139493059-139493081 CTCCCTGCAGGTAGAAGGAGAGG + Intergenic
1033278965 7:139992391-139992413 CCCTCTGCTGGGAGCTGGCGGGG - Intronic
1033356850 7:140607179-140607201 TTCCCTGCTAGGTGATGGGATGG + Intronic
1033595157 7:142854225-142854247 CTCCCTGCAGTGAGGAGGGGCGG - Intergenic
1034285272 7:149879754-149879776 CATCCTGCTGGGAACTGGGGGGG + Exonic
1034976458 7:155451577-155451599 CTCCTTCCTGGTAGACGGGGAGG + Intergenic
1035158085 7:156930343-156930365 CTTCCCACTGGGAGAAGGGGAGG - Intergenic
1035383003 7:158452404-158452426 GTCTCCACTGGGAGATGGGGAGG - Intronic
1035792170 8:2317100-2317122 CACCCTGCAGGCAGATGGTGAGG - Intergenic
1035800635 8:2404605-2404627 CACCCTGCAGGCAGATGGTGAGG + Intergenic
1036222334 8:6931194-6931216 CTTCCCGCTGGGAGCAGGGGTGG + Intergenic
1036285426 8:7440969-7440991 CTCACTGCTGGCAGGTGGGAGGG + Intergenic
1036336050 8:7870560-7870582 CTCACTGCTGGCAGGTGGGAGGG - Intergenic
1037134525 8:15445836-15445858 CTCCCAGATGGTAGACGGGGTGG + Intronic
1038319674 8:26514818-26514840 CACCCTGCGCGGAGAAGGGGCGG - Intronic
1038426111 8:27464977-27464999 CTCCCTTCTGGGAGGTGAGCAGG + Intronic
1039097853 8:33905892-33905914 TTCCCTGCTGAAAAATGGGGTGG + Intergenic
1040454233 8:47579890-47579912 CTCCCTCCTGGGAGATGGTCTGG + Intronic
1040981673 8:53251387-53251409 CTCCGTGCTGGGAGGTGGGAAGG - Intronic
1041673590 8:60516790-60516812 CGCCCTGCTGGAAGACAGGGCGG + Intergenic
1041857689 8:62477099-62477121 GTTCCTGCAGAGAGATGGGGAGG + Intronic
1043621077 8:82192631-82192653 CTGCTTGCTGGGAGGTGTGGAGG - Intergenic
1044129991 8:88509793-88509815 CTCCTTGATGGGGGATGGGGAGG + Intergenic
1045778474 8:105835156-105835178 GTACCTGGTGGGAGATGTGGGGG + Intergenic
1046521436 8:115330945-115330967 CTGCTTGCAGGGAGATGTGGAGG - Intergenic
1046654177 8:116874615-116874637 CTCTCCGCTGGGAGTTGGGCGGG + Exonic
1047585598 8:126268738-126268760 CTCCCTCCTGGGAGACTGGCTGG - Intergenic
1047772236 8:128038831-128038853 CACCCTGCTGAGAGCTGGGCAGG + Intergenic
1048693012 8:136989270-136989292 CTCTCTGCTGAGAGTTGGGCAGG - Intergenic
1049220657 8:141427375-141427397 CTCCCTGCTGGGAGAACGGGAGG + Intronic
1049320172 8:141992079-141992101 CTGGCTGCTGGGAGAGTGGGTGG - Intergenic
1049353375 8:142175968-142175990 CTCCCCACAGGGAGATGGGTAGG - Intergenic
1049407884 8:142459879-142459901 CTGCCTGCTGGGGGCAGGGGCGG - Intronic
1049849566 8:144823519-144823541 CTCCCTGCTGGAATGAGGGGAGG - Intergenic
1049944553 9:581156-581178 CTGCTTGCGGGGAGATGTGGAGG - Intronic
1050592929 9:7178863-7178885 CACAATGCTGGGAGGTGGGGAGG + Intergenic
1052325897 9:27216500-27216522 ATAACAGCTGGGAGATGGGGTGG + Intronic
1052612910 9:30799590-30799612 CCACCTGCTGGAAGATGGCGAGG - Intergenic
1053137576 9:35661054-35661076 CTACTTCCTGGGAGGTGGGGCGG + Exonic
1053393358 9:37751856-37751878 CAGCCTGCCGGGAGGTGGGGAGG + Intronic
1053592974 9:39533134-39533156 CTCCCTGCTCTGAGATGTTGGGG - Intergenic
1053850710 9:42287842-42287864 CTCCCTGCTGTGAGATGTTGGGG - Intergenic
1054573332 9:66832143-66832165 CTCCCTGCTCTGAGATGTTGGGG + Intergenic
1054956485 9:70916879-70916901 GTCAGTGCTGGCAGATGGGGAGG + Intronic
1055479618 9:76696750-76696772 ATCCCTGGTGGGAGATGCGGGGG + Intronic
1055708769 9:79036536-79036558 CTGCCTGCTGAAAGATGGCGAGG - Intergenic
1057268133 9:93632133-93632155 CTCCCTGCAGGGACAGGGGCAGG - Intronic
1057813240 9:98273920-98273942 GTCAGTGCAGGGAGATGGGGTGG + Intergenic
1058365142 9:104200573-104200595 CTGCTTGCGGGGAGATGTGGAGG + Intergenic
1059283927 9:113156803-113156825 CTCCTTTCTTGGAGATTGGGAGG + Intronic
1059374300 9:113870308-113870330 CTCCCTGTGCGGGGATGGGGAGG + Intergenic
1059547654 9:115194477-115194499 CTTCCTGTTGGAAGCTGGGGAGG + Intronic
1060204882 9:121676566-121676588 CTCCATGCAGGGTGCTGGGGAGG + Intronic
1061542998 9:131288445-131288467 CTCCCAGCTGGTTGATGGCGGGG + Intergenic
1061706690 9:132458334-132458356 CTCCCTGGCGGGGGAGGGGGGGG + Intronic
1061715294 9:132514968-132514990 CTCCCAGCAGAGAGCTGGGGCGG - Intronic
1062365652 9:136207803-136207825 CCCTCTGTTGGGGGATGGGGAGG - Exonic
1062499870 9:136847684-136847706 CTCCCCGCTGGGAGGCGGGGTGG + Exonic
1062584355 9:137242215-137242237 CTCCCTGCAGGGAGCTGAGCTGG + Intronic
1062615914 9:137395623-137395645 CTCCCTGCTGAAAGCTGGGACGG - Intronic
1062623864 9:137434327-137434349 CTCCCTGCTGGGATCGGGGCAGG - Exonic
1203453727 Un_GL000219v1:145030-145052 TGCCCAGCTGGGAGATGGTGGGG - Intergenic
1186082752 X:5951442-5951464 CTCTCTGCTGGGAGGACGGGGGG + Intronic
1187962753 X:24582178-24582200 CTGCCTGCTGAAAGATGGGATGG - Intronic
1188399933 X:29731711-29731733 CCCCCAGCTGGGAGCTGGAGGGG + Intronic
1188578925 X:31686863-31686885 TTCACTGCTGGGAGTAGGGGAGG - Intronic
1189155962 X:38757121-38757143 ATTCCAGCTGAGAGATGGGGAGG + Intergenic
1190149851 X:47936426-47936448 CTTCCTGCTGAGGGGTGGGGCGG - Intronic
1194322080 X:92460802-92460824 CCGCCTGCTGGAAGATGGCGAGG + Intronic
1195856476 X:109338049-109338071 CTCCCTGCCTGGTGATGGAGGGG + Intergenic
1196250242 X:113451911-113451933 CTCCATTCTCTGAGATGGGGAGG + Intergenic
1196679148 X:118453207-118453229 ATCCCTACTTGGAGAGGGGGAGG + Intergenic
1196755706 X:119155519-119155541 CTGCCTGATGGGAGAGGAGGAGG - Intergenic
1197199986 X:123740349-123740371 CTCCCTGCTGGGATATGAATTGG - Intergenic
1197551705 X:127900143-127900165 CTCCCTGAAGGGAGATGGTCTGG - Intergenic
1200123980 X:153804645-153804667 CTCTCTGCTGGCCGAGGGGGCGG - Exonic
1200630243 Y:5574281-5574303 CCGCCTGCTGGAAGATGGCGAGG + Intronic
1201759005 Y:17518151-17518173 CTCCCTGCAGGGAGCTGAGCTGG - Intergenic
1201842550 Y:18387839-18387861 CTCCCTGCAGGGAGCTGAGCTGG + Intergenic