ID: 1076814840

View in Genome Browser
Species Human (GRCh38)
Location 10:132909610-132909632
Sequence CTGGAAAGCCAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076814840_1076814853 15 Left 1076814840 10:132909610-132909632 CCCTCCTCCATCTGGCTTTCCAG 0: 1
1: 0
2: 2
3: 45
4: 449
Right 1076814853 10:132909648-132909670 GCCCTGGGCCCACTCCTCCTTGG No data
1076814840_1076814850 -1 Left 1076814840 10:132909610-132909632 CCCTCCTCCATCTGGCTTTCCAG 0: 1
1: 0
2: 2
3: 45
4: 449
Right 1076814850 10:132909632-132909654 GGAGCTCATGGGGCCGGCCCTGG No data
1076814840_1076814855 16 Left 1076814840 10:132909610-132909632 CCCTCCTCCATCTGGCTTTCCAG 0: 1
1: 0
2: 2
3: 45
4: 449
Right 1076814855 10:132909649-132909671 CCCTGGGCCCACTCCTCCTTGGG No data
1076814840_1076814848 -7 Left 1076814840 10:132909610-132909632 CCCTCCTCCATCTGGCTTTCCAG 0: 1
1: 0
2: 2
3: 45
4: 449
Right 1076814848 10:132909626-132909648 TTTCCAGGAGCTCATGGGGCCGG No data
1076814840_1076814851 0 Left 1076814840 10:132909610-132909632 CCCTCCTCCATCTGGCTTTCCAG 0: 1
1: 0
2: 2
3: 45
4: 449
Right 1076814851 10:132909633-132909655 GAGCTCATGGGGCCGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076814840 Original CRISPR CTGGAAAGCCAGATGGAGGA GGG (reversed) Intronic
900584152 1:3424492-3424514 CGTGGAGGCCAGATGGAGGAAGG + Intronic
900889900 1:5442073-5442095 CTGGAAGACCTGATGGAGGGAGG + Intergenic
901613120 1:10515064-10515086 CTGGAGAGCCCGCTGGAGGACGG - Intronic
902416773 1:16244383-16244405 CAGGTAGGCCAGCTGGAGGATGG + Intergenic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903279427 1:22242124-22242146 CTGGAAATCAAGGTGGGGGAGGG + Intergenic
903543191 1:24108250-24108272 CTGGAAACCCTGTTTGAGGAGGG - Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904627338 1:31814509-31814531 CTGGAGAGCCAGGTGGAAGTGGG - Exonic
904899799 1:33847935-33847957 CTGGAAATCAAGATGAAGAATGG - Intronic
905512907 1:38536935-38536957 TTAGAAAGCCAGATTGAGGACGG + Intergenic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
907653340 1:56317841-56317863 ATGGGAAGCCAGTTGGATGAGGG - Intergenic
908496053 1:64696075-64696097 GTGGAAATCCAGAGGTAGGATGG - Intergenic
908796175 1:67833213-67833235 CTGGGAAGCGAGATGGAGGGAGG - Intronic
910220974 1:84889207-84889229 CTGGCAAGCCAGCTGGAGGGTGG - Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914585763 1:149060346-149060368 CTGGAAGCCCAGATGAGGGATGG - Intronic
914830509 1:151167423-151167445 CGGGAAAGCCAGAGGTAGGAAGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915583837 1:156832610-156832632 CTGCAAAGCCCTCTGGAGGATGG + Intronic
916215606 1:162390533-162390555 CCGGGAAGCCACCTGGAGGAAGG - Intergenic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
917877025 1:179295174-179295196 CTGGAAAGCCAGAAGGAAAGTGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920245005 1:204580770-204580792 CTAGAAAGCCAGATAGAAAAGGG - Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
922340746 1:224652984-224653006 CCGGAAGGCCAGCTGGAGGAAGG + Intronic
922620010 1:226983460-226983482 CTGGGAAGCCAGTTGGGGGTTGG + Intronic
922712176 1:227842538-227842560 GTGGAAGGCCAGATGGGGCAGGG - Intronic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1063268408 10:4479493-4479515 CTGAAAAGGGAGATGGATGAGGG + Intergenic
1064267680 10:13838191-13838213 CTGGGAAGCCTGAGGCAGGATGG - Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064710795 10:18122378-18122400 CTGCAAAGCCACATGGAGTGGGG + Intergenic
1065045806 10:21746886-21746908 CGGGAAAGGCAGATGGGAGAAGG + Intergenic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1067740700 10:48894158-48894180 CTGAATAGCCATATAGAGGATGG - Intronic
1068584562 10:58782700-58782722 CTGGAAAACCTGATTGAAGAGGG + Intronic
1068946091 10:62730238-62730260 TGGGACAGCCAGAGGGAGGATGG - Intergenic
1069479073 10:68764200-68764222 ATTGAAACCCAGATGGAGCAAGG - Intronic
1069895968 10:71680241-71680263 CTGGACAGCCAAAGGGAGGCAGG - Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070610457 10:77928647-77928669 CTAGAAAGCTAGTTGGAGGAAGG + Intergenic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1072727253 10:97822175-97822197 ATGGAAAGCTAGAGGCAGGAAGG - Intergenic
1073313182 10:102558946-102558968 ATGGCAAGCCATCTGGAGGAGGG + Intronic
1073428409 10:103470541-103470563 GTGGAAAGAAAGATGGAGGGAGG - Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075295248 10:121269696-121269718 CTGGGAAGCCACCTGGAGCATGG + Intergenic
1075356261 10:121779706-121779728 GTGGTAAGTCTGATGGAGGAAGG - Intronic
1075414557 10:122252844-122252866 CTGAAATGCCAGCTGGACGATGG - Intronic
1075714966 10:124550748-124550770 CTGGAATGCCAGCTGGGGGCAGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077392612 11:2307085-2307107 CTGCAAGGCCTGATGGGGGATGG - Intronic
1077427173 11:2487079-2487101 CTGGAAATCCACATGCAAGAGGG - Intronic
1078174737 11:8961761-8961783 CTGAAAAGCAAGAGGGAGAAAGG + Intronic
1078529609 11:12126859-12126881 CTGGAAAGCTTCCTGGAGGAGGG + Intronic
1078932761 11:15925325-15925347 CCAGAAAACAAGATGGAGGAAGG - Intergenic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1080248152 11:30203031-30203053 CAAGACAGCCAGATGGAAGAGGG - Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1084214811 11:67641504-67641526 CTGGCAGGCAAGATGGATGAGGG - Intergenic
1084558281 11:69888127-69888149 CTGGACAGCAAGAAGGAGCAAGG - Intergenic
1085271568 11:75273068-75273090 GTGGCTAGCCAGATGGGGGATGG - Intronic
1085998116 11:81947157-81947179 GTGAAAATCCAGATTGAGGATGG - Intergenic
1086573185 11:88308143-88308165 GTGGAAGGCAAGATGGGGGATGG - Intronic
1087757525 11:102070499-102070521 CAGGAACTCCAGATGGAGAAAGG - Intronic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089046487 11:115505116-115505138 CGGGAAAGGTAGATCGAGGAGGG + Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089342048 11:117764709-117764731 TTGCAAAGCCTGATGGAGCATGG - Intronic
1089623971 11:119739725-119739747 TTGGCAAGTCAGGTGGAGGAAGG - Intergenic
1089671956 11:120062817-120062839 CTGGGAAGCCTGATGGAGTCGGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1091339626 11:134800374-134800396 CGGGAAAGCCAGCGGGAGGTGGG - Intergenic
1091768610 12:3137582-3137604 CTTTCCAGCCAGATGGAGGAGGG + Intronic
1091915765 12:4271182-4271204 CTGTAAAGCAAGACGGAGTAGGG + Intergenic
1094275245 12:28668310-28668332 CTTGAAAGCCACATGGGGCAGGG + Intergenic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096077093 12:48812716-48812738 CTGCAGAGCAAGATGGAGAAGGG + Intergenic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1097945914 12:65367212-65367234 TTGTAAAGCCAGATGAAAGAGGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099871477 12:88355074-88355096 TTGGGTAGCCACATGGAGGATGG - Intergenic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101492502 12:105222498-105222520 GTGGAAGGCCAGATGGAGAACGG + Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102763340 12:115408712-115408734 CTGGAAGGCTGGATGCAGGAGGG + Intergenic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1103587102 12:121963942-121963964 CTGGAAAGAAGGATGGAGGCAGG + Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1106070523 13:26406963-26406985 CTGGACAGCCAGAAGGGGGGAGG - Intergenic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106442063 13:29784226-29784248 CGGGAAAGAAAGAGGGAGGATGG + Intronic
1108090287 13:46842469-46842491 CTGGAAAGCTAGATTGCGGCAGG + Intronic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108239408 13:48446442-48446464 CTAGCAAGCAAGATGCAGGAAGG - Intronic
1108382113 13:49864216-49864238 CTGGAAAACAGGATGGAGGCTGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110506235 13:76290363-76290385 TTGGAAAGGGTGATGGAGGATGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1112777980 13:102866370-102866392 CTGGAAAGCCAGGTGGGTGCAGG + Exonic
1113230222 13:108205695-108205717 CTGGAAAGTCATATGGTGTAGGG - Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1114359139 14:21950526-21950548 CAATCAAGCCAGATGGAGGAGGG + Intergenic
1114504175 14:23196331-23196353 CTTGGAAGCCAGCTGGAGGTTGG - Intronic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115323223 14:32108143-32108165 AGGGAAAGCCAGATGGAAGTGGG + Intronic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1117985647 14:61383935-61383957 CCTGAAAGCCAGGTGGAGCAGGG + Intronic
1121123207 14:91389306-91389328 CGGGAAGGCCAGGAGGAGGATGG - Intronic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1121708269 14:96017520-96017542 CTGGGAAGCCACATGGAGTCAGG - Intergenic
1122020265 14:98832076-98832098 GTGGAAAGTCAGATGCAGGTTGG - Intergenic
1122341723 14:101032985-101033007 CTGGAAGGCCTGATGGATGGTGG + Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1123003785 14:105311767-105311789 CTGGGAAGCCATGTGGGGGATGG - Exonic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1124873438 15:33566690-33566712 CAGGAAGGCCACATGGATGATGG + Exonic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125883607 15:43212788-43212810 CTGGGAAGCTAGAAGCAGGAGGG + Intronic
1127588878 15:60402854-60402876 CAGGAAAACAGGATGGAGGAAGG - Intronic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128305813 15:66598286-66598308 CTTGAAAGCCTGAGGGTGGAAGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129228637 15:74184326-74184348 CTTGAATGCCAGAAGAAGGAGGG + Intronic
1129848333 15:78778170-78778192 AGGGAATGCCAGCTGGAGGAAGG - Intronic
1130253593 15:82315764-82315786 AGGGAATGCCAGCTGGAGGAAGG + Intergenic
1132113545 15:99119466-99119488 CTGGAAGACAAGATGAAGGATGG + Intronic
1132142499 15:99407272-99407294 CTGCAAAGCCAGGTGCAGCAGGG + Intergenic
1132793413 16:1706343-1706365 ATGGAGATCCAGATGGACGAGGG + Exonic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1133012385 16:2921367-2921389 TTCTAAAGCCAGAGGGAGGATGG + Intronic
1133619715 16:7514588-7514610 AAGGAAAGCCTGCTGGAGGAGGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1135977494 16:27118592-27118614 CTGGAATGCAAGGAGGAGGATGG + Intergenic
1136178517 16:28535111-28535133 CTGGGAAGTGAGATGGGGGAGGG - Intronic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137053972 16:35734764-35734786 CTGGAAAGCGACAAGCAGGAAGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138742750 16:59329905-59329927 TTGGAAAGCCAGATTAGGGAGGG - Intergenic
1139157946 16:64466949-64466971 CTGGCTAGCCATATGCAGGAAGG + Intergenic
1139535624 16:67571232-67571254 CTGCAAAGTCAGTTTGAGGAGGG - Exonic
1139550366 16:67669468-67669490 AGGAAAAGCCAGTTGGAGGAAGG - Intergenic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1140026947 16:71299354-71299376 CTGGAAGGCCAAGTGAAGGATGG - Intergenic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1142971040 17:3611719-3611741 CTGAAAAGCAAGTTGTAGGATGG - Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143998346 17:11028973-11028995 CAAGAAAGCCAGTGGGAGGATGG + Intergenic
1144027303 17:11289458-11289480 GTGGTAAGGGAGATGGAGGATGG - Intronic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1144582336 17:16465991-16466013 AGGGAAAGCCAGATAGAGGCTGG + Intronic
1144724012 17:17492328-17492350 CTGAAATGCCAGAAGGGGGAAGG - Exonic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146972988 17:37087440-37087462 CTGGAAAGGAAGATTGAGAATGG + Intronic
1147219843 17:38922053-38922075 GTGGAAAGCCAGAAGTAGGTTGG - Intergenic
1147319915 17:39639883-39639905 CAGAAAAGCCACAGGGAGGAGGG - Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148001450 17:44389887-44389909 CTGTACAGCCAGATGGGGGAAGG - Intergenic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1148481938 17:47965610-47965632 AAGGAAAGCCATATGCAGGAAGG - Intergenic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1149301167 17:55305594-55305616 CTAGAAAGCCAGGGGGAGGCTGG - Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150259539 17:63777406-63777428 CTGGAAAGGGAGTTTGAGGAAGG + Intronic
1150572417 17:66398710-66398732 CGAGAAAGGCAGATGGATGATGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152063746 17:78098483-78098505 CTGGCACCCCAGGTGGAGGAGGG - Exonic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153466649 18:5395555-5395577 CTTGAGAGCGAGCTGGAGGAAGG - Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1156297885 18:35809178-35809200 GTGGAAAACTAGAGGGAGGAAGG - Intergenic
1156497729 18:37537033-37537055 CGGGAAAGCCAGGCTGAGGATGG - Intronic
1156801539 18:41120856-41120878 CTACAAAGCCAGATGGAAAAGGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158112096 18:53951727-53951749 CTGGGATGCCAGGTGGAGGGAGG - Intergenic
1158201411 18:54945897-54945919 CTTGGAAGCCAGAGAGAGGATGG + Intronic
1158961845 18:62594368-62594390 CTGCAAAGCAAAATGGATGATGG + Intergenic
1159525614 18:69584949-69584971 CTGGCAAGCTAGATGAAAGAAGG - Intronic
1161053306 19:2176868-2176890 CTGGAATTCCAGCTTGAGGAGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162439220 19:10682434-10682456 CCGGGAAGCCATCTGGAGGAGGG - Intronic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1162901399 19:13797011-13797033 CTAGAAACCCAGGTGGAGTAGGG + Intronic
1163478976 19:17543339-17543361 CTGGTCAGCCAGCTGCAGGAAGG - Exonic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1166978985 19:46621734-46621756 CTGGTAAGCAAGTGGGAGGAGGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1168168875 19:54573538-54573560 CTGGAAGGGCAGACGCAGGAGGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927274488 2:21250960-21250982 CTGGAGAGTGAGCTGGAGGAAGG + Intergenic
927515600 2:23670068-23670090 CTGAGAACCCAGATGCAGGAAGG - Intronic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
930261659 2:49154091-49154113 TTGGAAAGCCACAGGCAGGAGGG + Intronic
930641678 2:53859851-53859873 CCGGACTGCGAGATGGAGGAGGG - Exonic
932986620 2:76733648-76733670 AGGGAAAGCCAGATGAAAGAGGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
934928261 2:98397163-98397185 CTGGAAAGCCAGGTGAAGGGTGG + Exonic
936125241 2:109783703-109783725 CAGGAAGGCCAGATGCAGGGTGG + Intergenic
936141253 2:109943613-109943635 CTGGGAAGCCACATGTAGAAGGG + Intergenic
936177941 2:110241562-110241584 CTGGGAAGCCACATGTAGAAGGG + Intergenic
936203440 2:110427869-110427891 CTGGGAAGCCACATGTAGAAGGG - Intronic
936219452 2:110587765-110587787 CAGGAAGGCCAGATGCAGGGTGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936530265 2:113271421-113271443 TTGGAAAGGCAGAGGGAGGGAGG - Intronic
936649732 2:114412587-114412609 CTGGAAAGCGACACGGAGAATGG - Intergenic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937086443 2:119174894-119174916 CTAGAACGGCAGAGGGAGGAGGG + Intergenic
938694640 2:133824253-133824275 TTAGAAAGCCAAATGGAGGCTGG - Intergenic
938729238 2:134133446-134133468 CTGAAATGCCAGGTGAAGGATGG + Intronic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940155044 2:150646998-150647020 ATAGAATGCCAGATGGAGCATGG - Intergenic
940669861 2:156654081-156654103 CTGGAAGGCAAGAAAGAGGAAGG - Intergenic
943095500 2:183423445-183423467 CTGGAAAGCAAGCTGGTTGAAGG - Intergenic
943195760 2:184746692-184746714 CTGGAAAGGGTGATGGGGGAGGG - Intronic
943413363 2:187566776-187566798 CTAAAAGGCCAGATAGAGGAAGG + Intergenic
944531876 2:200675123-200675145 CTGGAATGCCAGCTAGAGGATGG + Intronic
945221140 2:207485481-207485503 CTGGAAAGGAAGGTAGAGGAAGG + Intergenic
946009079 2:216550298-216550320 CTGGAAAGCCAGGCAGAGGCAGG - Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
946326401 2:218986653-218986675 CTGGGATGCCTGATTGAGGATGG + Intergenic
946337904 2:219050571-219050593 CTGTAAGGCCAGCTTGAGGAAGG + Intergenic
947307891 2:228767308-228767330 CTGAAAAGCTAGATAGAGGAGGG - Intergenic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
947779160 2:232741962-232741984 CTGGAAAGAGAGTCGGAGGAAGG - Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948826954 2:240577496-240577518 CTGGGAAGCCAGGGGCAGGAGGG + Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
948988824 2:241541637-241541659 CTGGAGAGCGAGATGCTGGACGG - Intergenic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171025640 20:21628265-21628287 CTGGCAAGCCAGAAGTAAGAGGG - Intergenic
1171283038 20:23917417-23917439 CTAGAAAGCCAGGAGGAGAATGG - Intergenic
1172009481 20:31838030-31838052 CTGGAACCCCAGTGGGAGGATGG + Intergenic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172595928 20:36151183-36151205 CAGGAAAGCCAGGAGGAGAACGG - Intronic
1173013240 20:39201300-39201322 CAGAAATGCCTGATGGAGGAAGG - Intergenic
1173580149 20:44141391-44141413 AGGGAAAGGCAGATGGAGGCGGG + Intronic
1173928869 20:46801554-46801576 AGGGAAAGTCAGATGGGGGAGGG + Intergenic
1174289268 20:49496212-49496234 GTGGAAAGACAGATGGTGTACGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175390974 20:58627206-58627228 CTGTAGTGCAAGATGGAGGAGGG + Intergenic
1175600294 20:60267342-60267364 GTGGAAAGTGAGATGGAGCAGGG + Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176084927 20:63291513-63291535 CGGGACAGCCAGTTGGTGGATGG + Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179116188 21:38494762-38494784 CTGGAAAGCAGGATTGAGAATGG - Intronic
1179162772 21:38911532-38911554 AGGAAAAGCCAGAGGGAGGATGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1182613668 22:31570869-31570891 CCCGAAAGCCAGGTGAAGGAAGG + Intronic
1182716457 22:32359691-32359713 CTCTAAGGCCAGGTGGAGGAGGG - Intronic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184057391 22:42061508-42061530 CTGGAAAACCTTCTGGAGGATGG - Intronic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185144441 22:49123351-49123373 ATGGGCAGCCAGATGGAGGCTGG - Intergenic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950456774 3:13097400-13097422 GTGGACAGCCAGGTGGAGTATGG - Intergenic
951362655 3:21742774-21742796 CTGAAAAGCCACATGGGGAATGG - Intronic
953005738 3:38977636-38977658 CTGGAAAGGCAGGTGAAGGTAGG - Intergenic
953215841 3:40917350-40917372 CAGGAAATCCTGATGGAGAATGG - Intergenic
954453935 3:50586793-50586815 CTGGAAAGCCAGGTGGGGTGGGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956955875 3:74339193-74339215 CTGGACAGCTGGAGGGAGGAGGG - Intronic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957816781 3:85310628-85310650 CTGGAAAGCTAAAGGGAGCATGG + Intronic
958139520 3:89543401-89543423 CAGGATAGCCAACTGGAGGATGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
962294322 3:134167559-134167581 CTGGATAGCCATATGTAGAAAGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
963303878 3:143628159-143628181 AGGGACAGCTAGATGGAGGATGG + Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
968617352 4:1583770-1583792 CTGGAAAGCAAGCTGGCGGCAGG - Intergenic
970267678 4:14306915-14306937 CTGGACTGCCATATGGAGAAGGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971541428 4:27821800-27821822 CTTGACAGCCAGATAGAGAAAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977655739 4:99518790-99518812 GTGGAAATCCAGACGGAGGTGGG - Intronic
978230474 4:106391842-106391864 GTGGGAGGCCAAATGGAGGAGGG - Intergenic
979495139 4:121374972-121374994 CGGCACAGCCAGAGGGAGGATGG - Intronic
979913703 4:126404294-126404316 CTGCCAAGCCAGCTGGAGGAGGG - Intergenic
980807969 4:137837924-137837946 CTATAATGCCACATGGAGGAGGG - Intergenic
982290754 4:153780139-153780161 CTGGAATGCAAGGAGGAGGAAGG - Intergenic
983301501 4:165931991-165932013 CTGGAAAGCCAGGTGATGGTTGG + Intronic
983935854 4:173502157-173502179 AGGGAAAGCCAGGTTGAGGAAGG - Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985138373 4:186812450-186812472 CTGGAATGCCACATGCATGATGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986040311 5:3987892-3987914 ATGGAAGGGCAGATGGAAGAAGG + Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990494108 5:56329553-56329575 ATGGAAAGCCAGATGGCTGAAGG - Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
992016863 5:72584048-72584070 CTGTAAAGCCATATAGATGAAGG + Intergenic
992052560 5:72955232-72955254 TTGGAAAGCAAGGTGTAGGAAGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992364702 5:76079954-76079976 TTTGAAAGCCAGCTGAAGGATGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
995234160 5:109807227-109807249 CTGGAAAACAGGATGGAGGTGGG - Intronic
997260741 5:132463996-132464018 CTCCAACACCAGATGGAGGAGGG + Exonic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
999250344 5:150178687-150178709 TTGGAAAGCCACAGGTAGGAGGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000293817 5:159895690-159895712 TTGGAATGCCAAAGGGAGGATGG - Intergenic
1000389445 5:160707935-160707957 CTGGAATGCCTGATGGGGGTTGG + Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002789548 6:427306-427328 CTTGCAAGCCGCATGGAGGAGGG - Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003665926 6:8111348-8111370 CTGCACAGCCAAATGCAGGAAGG - Intergenic
1005199645 6:23329309-23329331 TTGAGAAGCCAGATGGAGGCTGG - Intergenic
1005394259 6:25364980-25365002 CTGGGAATCCAGATAGAGAAAGG - Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006812096 6:36826677-36826699 CTGGCAAGCTGGATGGATGAAGG + Intronic
1007264944 6:40588891-40588913 CTGGAAAGCCTGGTGGGGGAGGG + Intergenic
1007609282 6:43138875-43138897 CAAGACAGCCAGCTGGAGGAGGG + Exonic
1007667641 6:43524846-43524868 CTGGAAGGCCAGATGGACCAGGG + Exonic
1007825352 6:44595750-44595772 CTGGACTGCAAGATGGAGAAAGG + Intergenic
1007947219 6:45837393-45837415 CTGGGAAGCAAGAAGGAGCATGG + Intergenic
1008683787 6:53902146-53902168 CTGGAAAGCCATATTAAGGATGG - Intronic
1009969128 6:70608024-70608046 TTTGAAAGTCAGATGAAGGATGG - Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1012599222 6:101073554-101073576 CTGGCAAGTCAGATGGAGATAGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014213511 6:118731081-118731103 CTGACAAGCCAGATGCAGGATGG + Intergenic
1015281548 6:131440197-131440219 CTGGAAGGTCAGCGGGAGGATGG + Intergenic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016272390 6:142303046-142303068 CTGGAAAGCCAGACGGTGCTTGG - Intronic
1016523886 6:144977529-144977551 CTGCCAAGCCAGGTGCAGGAGGG + Intergenic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017502809 6:155040969-155040991 TTGTAATGCCTGATGGAGGAGGG + Intronic
1017812618 6:157994920-157994942 CTGGAAAGCAAGGTGGTGCAGGG - Intronic
1018324949 6:162656779-162656801 CTGGAAGGCCAGCTGTTGGAAGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1019067792 6:169317013-169317035 GTGGAAAGCCAGATGGAATTTGG - Intergenic
1020461178 7:8432160-8432182 CTGGGAATCCAGATAGAGGCAGG + Intergenic
1020476800 7:8605234-8605256 CTGGAATGCCAGTTGGGGAATGG + Intronic
1021105805 7:16638435-16638457 ATGAACAGCCAGATGGAAGAGGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023852647 7:44158852-44158874 CTGGATAGCCACAGTGAGGAGGG + Intronic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1028788386 7:94823717-94823739 TTGGATAGCCATATGGAGAAAGG + Intergenic
1028830842 7:95324958-95324980 CTTGAAATCCAGATGTTGGAAGG - Intergenic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032238182 7:130141883-130141905 CGGAAAAGCCACAGGGAGGAAGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032675485 7:134126405-134126427 CTGTAAGGCCAGAAGGATGAGGG + Intergenic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033020696 7:137721571-137721593 CTGGAAAGCAAGCAGGTGGAGGG - Intronic
1033269208 7:139915587-139915609 CTGGACAGCCTGGTGGAGAAGGG + Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035066394 7:156108327-156108349 CTGCAAAACCAGATGGATGCTGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1036012638 8:4744292-4744314 CAGGAAAGCAAAATGGAAGAAGG - Intronic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1037837426 8:22222315-22222337 TTGCCAAGCCAGACGGAGGAAGG - Intronic
1037856404 8:22374351-22374373 GTGGAAAGTCAGATGCAGGATGG + Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1038956849 8:32477234-32477256 CTGGAAAGCCGGCTGCAAGATGG + Intronic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1039854307 8:41399131-41399153 CCTGGAAGCCAGGTGGAGGAAGG - Intergenic
1039869470 8:41533399-41533421 CTTGAAAGGCAGCTAGAGGATGG + Intronic
1040937468 8:52796257-52796279 CTGGAAAGCCAGGTGAAGAAAGG - Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1043380693 8:79698877-79698899 CTGGAATGTCTCATGGAGGAGGG - Intergenic
1043398123 8:79858141-79858163 CTGGGAAGCCAGGTGGAGAATGG - Intergenic
1044135922 8:88585030-88585052 CCTGAAAGCCACATGGGGGAGGG - Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1049418368 8:142505764-142505786 CTGGGAAGCCAGGCGAAGGAGGG + Intronic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1051336617 9:16071434-16071456 CTGGAAAGTCTGAGGGAGCAAGG - Intergenic
1051672669 9:19527821-19527843 CTGGACAGCCATGTGGAGGCAGG - Intronic
1053482372 9:38424916-38424938 CTGGAAGCCGAGTTGGAGGATGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056647736 9:88429551-88429573 ATGAACAGCCAGATGGAAGAAGG + Intronic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1056831433 9:89920305-89920327 CTGGGAGGCCAGGTGGAGGGTGG + Intergenic
1057013808 9:91632609-91632631 CTTGAAAGCATGATGGATGATGG - Intronic
1057528922 9:95826973-95826995 CTGGAAGGCAAGAGGGAGCAGGG - Intergenic
1057943038 9:99301544-99301566 CTGGTAAGCGGGCTGGAGGATGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059245756 9:112848463-112848485 CTGCAAAGCCACATGCTGGAAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060312490 9:122475127-122475149 CTGCCAAGCTGGATGGAGGAGGG - Intergenic
1061194121 9:129098263-129098285 CTGCAAAGCCATCTGGATGAAGG + Exonic
1061304394 9:129724120-129724142 GTGGAAATCCGGATGGAGTATGG - Intergenic
1061398404 9:130355596-130355618 CTGGAAGGCCTCCTGGAGGAAGG + Intronic
1061626131 9:131841779-131841801 GTGAAAAGCCAGAGGCAGGAGGG + Intergenic
1061669968 9:132183144-132183166 CCAGGAAGCCAGAAGGAGGATGG - Intronic
1062249188 9:135585839-135585861 CTGGGAGGGAAGATGGAGGAGGG - Intergenic
1188024787 X:25196722-25196744 ATGGAAAGGTAGATGGGGGATGG + Intergenic
1188444986 X:30246739-30246761 CTGGAAGGTCTCATGGAGGATGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189846237 X:45141454-45141476 AGGGAGAGCGAGATGGAGGAGGG + Intergenic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1191146047 X:57166185-57166207 ATGGAAAGCCAGAGGGGGGATGG - Intergenic
1191915545 X:66197915-66197937 CTGGAAAGCCTGCTGGGAGAAGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1195382440 X:104283522-104283544 CTGGAAGGGCAGGTGTAGGAGGG + Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1197602244 X:128543865-128543887 CTTGAGAGCCACATGGAGCAGGG - Intergenic
1197666394 X:129228708-129228730 CTGGGAAGCCAGAGGTGGGATGG - Intergenic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic