ID: 1076815621

View in Genome Browser
Species Human (GRCh38)
Location 10:132913388-132913410
Sequence CTGTAAATGCAGATGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076815621_1076815623 -8 Left 1076815621 10:132913388-132913410 CCAAACTCCATCTGCATTTACAG 0: 1
1: 0
2: 0
3: 23
4: 261
Right 1076815623 10:132913403-132913425 ATTTACAGTCGCCCCGCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076815621 Original CRISPR CTGTAAATGCAGATGGAGTT TGG (reversed) Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
903317716 1:22521647-22521669 CAGAACATGCAGGTGGAGTTTGG + Exonic
903762360 1:25707734-25707756 ATGTAAATGCAGATCCAGGTCGG - Intronic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
906837836 1:49103110-49103132 CTGAAAATGCTGAGGGAGATTGG - Intronic
906925870 1:50115908-50115930 CTGTGATTGGAGATGAAGTTAGG + Intronic
907537033 1:55172073-55172095 GTGTTCATGTAGATGGAGTTTGG - Intronic
907544324 1:55246406-55246428 CACTACATTCAGATGGAGTTTGG + Intergenic
908068395 1:60432721-60432743 CTCTAAATACAGTTGCAGTTTGG - Intergenic
908819247 1:68066400-68066422 CAGAAAGTGCAGCTGGAGTTTGG + Intergenic
909296461 1:73955183-73955205 CTATATATGCATATGCAGTTTGG + Intergenic
910561251 1:88594119-88594141 TTGCAATTGCAGTTGGAGTTCGG - Intergenic
912585805 1:110764053-110764075 CTCTAAATGCTTATGTAGTTTGG - Intergenic
915346860 1:155201961-155201983 GTGTTGGTGCAGATGGAGTTTGG + Exonic
916746239 1:167686988-167687010 GAGTAAAAGCAGAGGGAGTTAGG + Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920211181 1:204329656-204329678 CTGTAAATGTAGTTAGATTTAGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
921119547 1:212124926-212124948 ATCTAGATGCAGATGGAGTCAGG - Intergenic
921563392 1:216686116-216686138 ATGTAAATGCAGCTGGTCTTGGG + Intronic
923982766 1:239343984-239344006 CTCTAAATGCAGTTGGGGCTGGG + Intergenic
923999636 1:239536094-239536116 CTCTGAATTCAGATGGAATTTGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1064846424 10:19659966-19659988 CTGTAAAGGGGGATGCAGTTAGG - Intronic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066663669 10:37761051-37761073 TTTGAAAGGCAGATGGAGTTGGG - Intergenic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1068941532 10:62685498-62685520 AATTAAATGCAGCTGGAGTTGGG - Intergenic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1075600025 10:123761006-123761028 CAGTCAATGCAGAGGGACTTCGG + Intronic
1076146741 10:128127777-128127799 CTGCAAATGCAGAAGCAGTGAGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1081029574 11:38061701-38061723 CTGACAAAGCAGATGGAGTTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084699484 11:70777098-70777120 GTGTAAATGCATATGTAGGTGGG - Intronic
1086969253 11:93063101-93063123 CTGCAGATGCAGATCAAGTTTGG - Intergenic
1087681223 11:101220074-101220096 CTGTTAAAGCAGGGGGAGTTTGG - Intergenic
1088370781 11:109086225-109086247 CCAAAACTGCAGATGGAGTTAGG - Intergenic
1090025164 11:123161368-123161390 CTTTAAATGCAGAATGGGTTCGG + Intronic
1093304789 12:17501765-17501787 TTCTAAATGCAGATGGTGTTTGG + Intergenic
1094447815 12:30551098-30551120 CTGTAAAATCACATGGACTTTGG - Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1095241234 12:39861204-39861226 CTGTAATAGAAGATGAAGTTGGG - Intronic
1098422836 12:70321568-70321590 CTGTAATTGCACATTGAGATTGG + Intronic
1099459419 12:82904224-82904246 CTGAGATTACAGATGGAGTTAGG + Intronic
1101302032 12:103492975-103492997 ATGGAAATGAAGATGGATTTAGG - Intronic
1101922981 12:108947884-108947906 CTGTGAAGGCAGATGGTGCTGGG + Intronic
1103466494 12:121145913-121145935 GTTTAAATGCAGATGGAAATGGG + Intronic
1106047318 13:26155290-26155312 ATGTAGATGCAGATAGATTTAGG - Intronic
1110961927 13:81637582-81637604 CTATAAAAGCAGCTGCAGTTGGG + Intergenic
1113246433 13:108401879-108401901 CTGTACTTGCAGATGCAGTCAGG - Intergenic
1115053829 14:29097884-29097906 CTCTAGAAGCAGATGGACTTGGG + Intergenic
1115108051 14:29784999-29785021 CAGTAAAAGGAGATGGAATTTGG - Intronic
1115629564 14:35230357-35230379 CTGTAAATTCTGATAGAGATGGG + Intronic
1116611224 14:47074654-47074676 CAGCAAATGCAGCAGGAGTTTGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1120883180 14:89430988-89431010 CCTTAAATGGAGATGGAGTTTGG - Intronic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1122397545 14:101444201-101444223 CTCTAAATGCAGATGGCAATGGG + Intergenic
1125101377 15:35916761-35916783 ATATAAATGCAGATGCTGTTGGG - Intergenic
1126328431 15:47506569-47506591 GTGTAAATGCCCATGTAGTTAGG - Intronic
1126337235 15:47599461-47599483 CTCAAAAAGTAGATGGAGTTTGG + Intronic
1126543024 15:49842792-49842814 TAGTAAATCCAGATGGAGTGAGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1130304088 15:82701155-82701177 GTATAAATGCAGATGGAGACTGG - Intronic
1132385709 15:101398492-101398514 CTGTAAATGTCGATGTAGTTGGG + Exonic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133427247 16:5703377-5703399 CTCTAAATTGGGATGGAGTTTGG + Intergenic
1133782605 16:8951550-8951572 CTGTAAATGCAGAGGGCTTGTGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134888587 16:17818104-17818126 TTGTAAATGCATATGGGGTTAGG + Intergenic
1135274729 16:21102327-21102349 CAGTAAATGCTGTTGAAGTTAGG - Intronic
1138601832 16:58060244-58060266 CTGAAAATGCAGGTGGAGCCAGG - Intergenic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1139772947 16:69293960-69293982 CTATAACTGCAGTTGGATTTAGG - Intronic
1140919044 16:79519971-79519993 CTGTCTGTGCAGGTGGAGTTGGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147662198 17:42122696-42122718 CTGCAAACGCAGGCGGAGTTCGG - Exonic
1147677552 17:42218589-42218611 CAGCAACTGGAGATGGAGTTGGG + Intronic
1147688486 17:42300982-42301004 CAGCAACTGGAGATGGAGTTGGG - Intronic
1148335341 17:46837302-46837324 TTGTCACTGCAGGTGGAGTTTGG - Intronic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150074142 17:62178478-62178500 GTCTGCATGCAGATGGAGTTTGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150601006 17:66651017-66651039 CTGTACCTGCAGTGGGAGTTTGG + Intronic
1150977581 17:70105991-70106013 CTGAGAATTCAGATGGAGTGCGG + Intronic
1153674166 18:7440743-7440765 CTGTAAAGGGAGATAGAGATAGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1163258172 19:16170358-16170380 CTTCTAAAGCAGATGGAGTTGGG + Intronic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
1166913807 19:46180107-46180129 CTCTCAATCAAGATGGAGTTAGG - Intergenic
1167424985 19:49425607-49425629 CTGTTATTGAAGATGGAGCTAGG - Intronic
926329458 2:11812649-11812671 CAGTCATTGCAGATGGGGTTGGG + Intronic
926361969 2:12097610-12097632 GTTTAAAAGAAGATGGAGTTGGG + Intergenic
928822470 2:35378090-35378112 CAATAAATGCAGAAGGAGTAAGG - Intergenic
932498847 2:72162434-72162456 CTGTAGATGGAGAAGCAGTTAGG - Intergenic
932624449 2:73286062-73286084 CTGCAAGAGCAGATGGATTTGGG - Intergenic
933613590 2:84461479-84461501 CTTTGTATGCAGATTGAGTTTGG + Intergenic
934759810 2:96848270-96848292 CTTTAAAGGCAGCTGGAGATAGG + Exonic
936530634 2:113274690-113274712 CTGTAATTATTGATGGAGTTGGG - Intronic
937108391 2:119341018-119341040 CAGAAAATGCTGATGGAATTGGG - Intronic
937653735 2:124350427-124350449 GTGTAAATGCAGATGGTTTGTGG + Intronic
938737008 2:134194911-134194933 CTGATAATGCAGTTGAAGTTGGG + Intronic
939535110 2:143417960-143417982 CTGCAACTGCTGATGGAGTAGGG + Intronic
940363579 2:152821236-152821258 CTACAAATGCAGATGGATGTTGG - Intergenic
941336450 2:164250162-164250184 CTGTCAATGTAGATGGAATAGGG - Intergenic
942689139 2:178566722-178566744 CAGAAAATGCTGCTGGAGTTGGG - Exonic
943319729 2:186432513-186432535 CTGTAATTGCTGATGGAGGGAGG - Intergenic
944298238 2:198092036-198092058 CTGGAGATGCAGGTGCAGTTGGG - Intronic
944361086 2:198857581-198857603 CTGTAAATGTAGATGAAATTAGG + Intergenic
944368510 2:198953852-198953874 GGGTAAAGGAAGATGGAGTTAGG - Intergenic
945769072 2:214016943-214016965 ATGGACATGCAGATGGTGTTAGG + Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946363508 2:219234052-219234074 CTCTCAATGCAGATGTAGCTGGG - Intronic
1169832829 20:9842710-9842732 CTGTTACTGAAAATGGAGTTAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174933777 20:54845069-54845091 CTATAATTCCAGATGGAATTTGG - Intergenic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1176229254 20:64023373-64023395 CTGTAAATGCTGATTAAATTTGG + Intronic
1177027821 21:15942693-15942715 CTGGAAATGTAGATTCAGTTTGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178997727 21:37420501-37420523 CAGTAAATGCAAAGGTAGTTGGG + Intronic
1179240065 21:39582028-39582050 TTGAAATTGCAGATGGAATTAGG + Intronic
1180698712 22:17770194-17770216 CTTAAAATGCAGATGGACTTGGG - Intronic
1180981725 22:19881288-19881310 CAGGAAATGCAGATGTTGTTTGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
949764274 3:7508869-7508891 TTGCCAATGCAGATGGACTTAGG - Intronic
949862741 3:8521404-8521426 CTGTCAAAGGGGATGGAGTTGGG - Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
951581632 3:24170841-24170863 TTTTAAATGCACATGGATTTTGG - Intronic
952170519 3:30801681-30801703 CAGTAAATGCAAATGGAATTTGG - Intronic
952446139 3:33382877-33382899 ATGTAGATGCAGATGGAATTGGG - Intronic
952662736 3:35871190-35871212 CTTTAAATGCAGATTCTGTTCGG - Intergenic
952836190 3:37604207-37604229 CTTTAAATGGAGAAGGAGTGGGG + Intronic
954928827 3:54262004-54262026 CTGTGAATGCAGTTGGGGATAGG + Intronic
955028925 3:55197865-55197887 CTTTAGATGCAGACGGAATTGGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957863167 3:85985654-85985676 CTTTAAATGTAGATGAATTTAGG + Intronic
959568121 3:107853415-107853437 CTGAAAATGCAAATGGGGCTGGG - Intergenic
959681198 3:109098500-109098522 CTGGAGATGCATATGGAGTTTGG - Intronic
959783622 3:110266701-110266723 CTGTCAATGAAGATGTAGCTTGG - Intergenic
959826726 3:110806005-110806027 CTGTAAAGGTAGTTGGAGTGTGG + Intergenic
960267069 3:115632290-115632312 CTGAAAATGTAGATACAGTTTGG + Intronic
960295369 3:115936447-115936469 CTGAAAATGCAGACAGAGTGAGG + Intronic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961146475 3:124598199-124598221 CTGTGATTTCAGATGGACTTGGG - Intronic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961356051 3:126340719-126340741 CTGAAAAAGCAGGTGGAGATGGG - Intergenic
962953910 3:140246876-140246898 CTATGAATTCAGATGGACTTGGG + Intronic
963409589 3:144910170-144910192 CTGTAAATGCACAGGGTGTACGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963693899 3:148540586-148540608 CAGAAAATGGAGCTGGAGTTGGG + Intergenic
963877801 3:150496090-150496112 CTGTGAATGCATCTGGAGTGGGG - Intergenic
964009987 3:151881084-151881106 CTGTAAATGAGGTTGTAGTTGGG - Exonic
964557395 3:157954476-157954498 CTATAAATGCAGACAGAATTAGG + Intergenic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
966914147 3:184575665-184575687 TTGTAGCTGCAGCTGGAGTTAGG + Intronic
967268965 3:187717432-187717454 ATGTAAATACATATGGAGTTGGG - Intronic
970567204 4:17343277-17343299 GGGTAAATGCAGTAGGAGTTAGG + Intergenic
970896749 4:21112397-21112419 CTTTGTATGCGGATGGAGTTTGG + Intronic
971253625 4:24993886-24993908 ACGTAAATGCAGATGGAAATGGG + Intergenic
971436695 4:26633606-26633628 TTGTAAATGCAGTTGGATTTAGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971980474 4:33743742-33743764 CTGTAAATTCAGATGTTGGTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975892283 4:79044171-79044193 CTGTCACTGAACATGGAGTTGGG + Intergenic
977351091 4:95888682-95888704 CAATAAATGTAGATGGATTTAGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979665581 4:123307299-123307321 TTCAAAATGCAGATGGAGCTGGG - Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981520584 4:145657833-145657855 ATATAAATGCTGATGAAGTTTGG + Exonic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983455325 4:167955773-167955795 CTTTAAATGCTCATGGATTTGGG + Intergenic
984248998 4:177309650-177309672 CTGTAAAAGCAGAAGAAATTGGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
986069275 5:4266150-4266172 CTGAAAATGCAAATGGTGCTGGG - Intergenic
986118084 5:4800485-4800507 CTGTGAAGGCAGGTGGAGCTGGG + Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986578359 5:9236150-9236172 CTATAATTCAAGATGGAGTTTGG + Intronic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990871140 5:60431800-60431822 CTGGGATTGCAGATGGAGTCTGG - Intronic
992965345 5:81993815-81993837 CTATAAATGAAGTTGTAGTTTGG + Intronic
993548566 5:89244454-89244476 CTGTAGGAGCACATGGAGTTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995797192 5:115954017-115954039 GTGTAACTGGAGATGGAGATTGG + Intergenic
996689059 5:126318073-126318095 CTGAATATGAAGGTGGAGTTGGG - Intergenic
997645743 5:135480794-135480816 ATGTAAAGTCAGATGGTGTTGGG - Intergenic
1000102151 5:158026319-158026341 CTATAAATGGGGATGGAGGTGGG + Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001247467 5:170115567-170115589 CTGTAACTGAAGACAGAGTTGGG + Intergenic
1001265407 5:170270721-170270743 ATGTACATGGAGTTGGAGTTGGG + Exonic
1002081309 5:176739233-176739255 CTGCAAATGTAGTTGGTGTTAGG - Intergenic
1002653074 5:180718206-180718228 CTGTTAATGCTGATTCAGTTCGG - Intergenic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1003511343 6:6783564-6783586 CTGGAAATGCAGAGGCAGATAGG - Intergenic
1004140870 6:13015639-13015661 CTGTAAATGCTGCTGCAGTGAGG + Intronic
1004206105 6:13592819-13592841 CTTTAAATGCAAATGGCCTTGGG - Intronic
1004651728 6:17616531-17616553 CTGTAAATGCTGCTGGAGACTGG + Exonic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005582559 6:27248526-27248548 AAATAAATGCAGATGGATTTAGG - Intronic
1006562809 6:34928161-34928183 CTGTAAATCTTGATGGAGATTGG + Intronic
1007486804 6:42186025-42186047 GTGGAAATGCAAATGGTGTTGGG - Intronic
1008766650 6:54925214-54925236 CTGGAAATTCAGGAGGAGTTTGG - Intronic
1009471848 6:64036253-64036275 CTGTTAAGGGTGATGGAGTTTGG + Intronic
1010632689 6:78217620-78217642 CTGAAAATGCAGAGGGATGTAGG - Intergenic
1011079393 6:83472982-83473004 TGGCAAAGGCAGATGGAGTTTGG - Intergenic
1012973671 6:105757180-105757202 ATGTAAATGCACACTGAGTTAGG - Intergenic
1013130121 6:107224568-107224590 CTGTATATGCAGAGGTAGTCAGG - Intronic
1013834026 6:114310883-114310905 CTGGAAAAGCAAATAGAGTTTGG + Intronic
1014294234 6:119598939-119598961 ATGTAAATGCATTTGGAGATAGG + Intergenic
1014796153 6:125727079-125727101 CTGTATATGAAGATGGGCTTGGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015605347 6:134949827-134949849 TTCTAAAAGCAGAGGGAGTTGGG - Intronic
1017336134 6:153262486-153262508 CTGTAAGTGCACATGGAGAGTGG - Intergenic
1019984543 7:4646256-4646278 CTGTAAGTGGAGATGGGCTTTGG + Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020757422 7:12220694-12220716 AAGTAAATGCAGATGTAATTTGG - Intronic
1021333885 7:19374646-19374668 AAGTAAATGCAGATGATGTTTGG - Intergenic
1021341985 7:19476312-19476334 TTGTAAATGCGCATGGATTTGGG - Intergenic
1022039066 7:26562812-26562834 CTTTACTTGCAGATGGAGGTTGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1025716797 7:63964795-63964817 CCGTCAATGCAGATGCAGTCAGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027878631 7:83803015-83803037 CTATAAATTCAGATAAAGTTTGG + Intergenic
1028356819 7:89920250-89920272 TTGTAAATGTTGATGGACTTAGG + Intergenic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1030964135 7:115968492-115968514 CTGTAAATGCTGGTGGCATTTGG - Intronic
1031008280 7:116499047-116499069 CTGCAAGTGCATGTGGAGTTGGG - Intronic
1031916352 7:127566413-127566435 CTGTAATTCCAGTTGGGGTTTGG - Intergenic
1031979581 7:128116029-128116051 CTGCAAATGCAGGAGGAGATAGG + Intergenic
1033790954 7:144791789-144791811 ATGTAAATGAAAATGGATTTTGG - Intronic
1034768135 7:153746993-153747015 CTGTAGATGCAGATGCTGGTTGG - Intergenic
1035324953 7:158059525-158059547 GTGTCACTGCAGATGGAGTGTGG - Intronic
1035957251 8:4094658-4094680 CTGTAAATGCATCTGAAGTGCGG - Intronic
1038281854 8:26172967-26172989 TTGAAAATGAAGATGGAGTGGGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039147362 8:34463924-34463946 ATGTTACTGCAAATGGAGTTTGG - Intergenic
1040503549 8:48026374-48026396 ATGTAAATGAATATTGAGTTTGG + Intronic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042514402 8:69644478-69644500 CTGTGACTGATGATGGAGTTTGG - Intronic
1042652386 8:71057688-71057710 CTGGAAATGGAATTGGAGTTGGG + Intergenic
1044825679 8:96194647-96194669 CTGTATTTGGAGAAGGAGTTTGG + Intergenic
1045830315 8:106452086-106452108 AACCAAATGCAGATGGAGTTAGG - Intronic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1046850385 8:118965551-118965573 CTGTAAATGCAAAGGAGGTTGGG + Intergenic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1051246012 9:15111873-15111895 ATGTAAATGAAGATGCAGATGGG + Intergenic
1051771558 9:20584793-20584815 CCTTAAATGCTGATGCAGTTTGG - Intronic
1053078023 9:35151546-35151568 CTGTACATCCAGATGGACTGAGG - Intergenic
1055534264 9:77221022-77221044 TTATTAATGCAAATGGAGTTGGG + Intronic
1056363448 9:85881244-85881266 CAGTAAAGGCAGATAGAGGTGGG - Intergenic
1060334694 9:122711057-122711079 CTGGGATTGCAGATGGAGTCTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1187050679 X:15692619-15692641 CTTTAAATGTAAATGGATTTTGG + Intronic
1188767439 X:34112881-34112903 ATATAAATGAAGATGGAGTGTGG + Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1191218056 X:57953392-57953414 CTGTAATTGGAGAATGAGTTTGG + Intergenic
1192177066 X:68892808-68892830 CTGTAACTGCAGCGGGAGTGGGG + Intergenic
1192434556 X:71135080-71135102 CTGTGCCTGCAGAAGGAGTTGGG + Exonic
1193458329 X:81758339-81758361 CTGTAAATCCATCTGGTGTTGGG - Intergenic
1195405348 X:104506845-104506867 ATGTACATGGAGATGGATTTGGG - Intergenic
1196531756 X:116796159-116796181 TTGTAAATTCAGGTGGAGTGGGG - Intergenic
1197907695 X:131443742-131443764 GTTTCAGTGCAGATGGAGTTAGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic