ID: 1076816070

View in Genome Browser
Species Human (GRCh38)
Location 10:132915296-132915318
Sequence AGCCCCGTCATTTCAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076816070_1076816084 8 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816084 10:132915327-132915349 TGGAGGCCCGGGGTGGGCCTGGG No data
1076816070_1076816083 7 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816083 10:132915326-132915348 CTGGAGGCCCGGGGTGGGCCTGG No data
1076816070_1076816078 -4 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816078 10:132915315-132915337 GGCTGTGAGGGCTGGAGGCCCGG No data
1076816070_1076816081 1 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816081 10:132915320-132915342 TGAGGGCTGGAGGCCCGGGGTGG No data
1076816070_1076816080 -2 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816080 10:132915317-132915339 CTGTGAGGGCTGGAGGCCCGGGG No data
1076816070_1076816077 -9 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816077 10:132915310-132915332 GACGGGGCTGTGAGGGCTGGAGG No data
1076816070_1076816085 13 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816085 10:132915332-132915354 GCCCGGGGTGGGCCTGGGCCCGG No data
1076816070_1076816082 2 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816082 10:132915321-132915343 GAGGGCTGGAGGCCCGGGGTGGG No data
1076816070_1076816079 -3 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816079 10:132915316-132915338 GCTGTGAGGGCTGGAGGCCCGGG No data
1076816070_1076816088 16 Left 1076816070 10:132915296-132915318 CCCCTGCCTGAAATGACGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1076816088 10:132915335-132915357 CGGGGTGGGCCTGGGCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076816070 Original CRISPR AGCCCCGTCATTTCAGGCAG GGG (reversed) Intronic
908322671 1:62993201-62993223 AGAGAGGTCATTTCAGGCAGAGG - Intergenic
908697916 1:66865744-66865766 AGCTCGGTCATTTCTGGCTGAGG - Intronic
911375599 1:97047061-97047083 AGCCAGCTCATTTCAGGGAGAGG + Intergenic
915028370 1:152854584-152854606 AGCTCTGTCATTGTAGGCAGTGG + Intergenic
916610784 1:166389408-166389430 AGCCCCTTATTTTCAGGCAGGGG - Intergenic
919911905 1:202116515-202116537 AGCCCTGTGATTTCAGGAATAGG - Intergenic
924612818 1:245588087-245588109 AGCCCCAGCCTTTCATGCAGAGG + Intronic
1064190449 10:13201405-13201427 TGCCCTGTCATTCCAGGCCGAGG + Exonic
1067684584 10:48458879-48458901 AGGCCCGTCACTGCAGCCAGGGG - Intronic
1070147591 10:73785986-73786008 ATCCCCGCCAGTTCTGGCAGAGG - Exonic
1072524314 10:96258079-96258101 AGCCTTGTCATTTCTGGCACCGG + Intronic
1073124397 10:101140590-101140612 AGACGGGTCATTTCCGGCAGGGG - Intergenic
1073582524 10:104681340-104681362 AGCCCCCACACTGCAGGCAGGGG - Intronic
1074554427 10:114475237-114475259 AGCTAGGGCATTTCAGGCAGAGG - Intronic
1076305251 10:129461555-129461577 AGCACCTTCATTCCTGGCAGGGG - Intergenic
1076816070 10:132915296-132915318 AGCCCCGTCATTTCAGGCAGGGG - Intronic
1077715535 11:4576348-4576370 ACCCACCTCATTTCAGTCAGGGG + Intronic
1082036054 11:47646188-47646210 AATCCCAGCATTTCAGGCAGAGG + Intergenic
1091020439 11:132094988-132095010 AGCTCCATCATTGCAGGGAGAGG + Intronic
1091209705 11:133845626-133845648 AGCCCCTGCATTTCAGGCTCTGG + Intergenic
1093828691 12:23728059-23728081 AGCCCTGTCCTTTCACTCAGAGG - Intronic
1093963493 12:25301378-25301400 AGCCTCTTCATATCAGGAAGGGG - Intergenic
1102188187 12:110965789-110965811 AGCCCAGTGATTTCAGGCGAAGG + Intergenic
1107335317 13:39348473-39348495 AGCCCTGTGAGTTCAGGCTGAGG + Intronic
1108069854 13:46617235-46617257 CAGCCCTTCATTTCAGGCAGAGG + Intronic
1112257587 13:97849237-97849259 AGGCCGGGCATTTCAGGCAGAGG - Intergenic
1113636191 13:111920571-111920593 AGCCCCGTCTGTTGAGGCAGTGG + Intergenic
1116388293 14:44359627-44359649 GGCCCCATCCTTTAAGGCAGGGG - Intergenic
1121495678 14:94390137-94390159 ACCACCCTCCTTTCAGGCAGCGG + Intronic
1202918789 14_KI270723v1_random:11936-11958 AGACCCCTAACTTCAGGCAGAGG + Intergenic
1202925847 14_KI270724v1_random:23118-23140 AGACCCCTAACTTCAGGCAGAGG - Intergenic
1128695103 15:69755870-69755892 AGCCCCTTCATTTCACTCTGAGG + Intergenic
1130141189 15:81227769-81227791 AGCCACGTCATTTCTGGCCTGGG - Intronic
1132242204 15:100266536-100266558 AGCAGCCTCATTCCAGGCAGTGG - Intronic
1132876864 16:2143888-2143910 TGCCCCCTCATTTCATGGAGAGG + Intronic
1135819087 16:25664608-25664630 AGCCAGGGCATTTCAGGCAGAGG + Intergenic
1140863121 16:79036540-79036562 AGCTCCGATAATTCAGGCAGAGG - Intronic
1140958730 16:79892361-79892383 AGCCCTGTGACTTCAGGCAAGGG - Intergenic
1142765731 17:2063160-2063182 AGGCCCGACATTGCTGGCAGGGG + Intronic
1143970623 17:10792592-10792614 AACCCCATCATTTCAGGGATGGG - Intergenic
1146291805 17:31613047-31613069 TGCACCCACATTTCAGGCAGTGG - Intergenic
1148723038 17:49768585-49768607 AGTCCTGACATTTCAGACAGAGG - Intronic
1150132012 17:62674492-62674514 AGCCTAGTCATGTCAAGCAGTGG + Intronic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1152538915 17:80965108-80965130 AGCCCCGTGGATTAAGGCAGGGG - Exonic
1153975641 18:10266449-10266471 AGCCCCTTCTTTTCAGGCAGAGG + Intergenic
1158438721 18:57454448-57454470 AGCTCTGTGATGTCAGGCAGGGG + Intronic
1160155545 18:76431481-76431503 AGCCCCGTCATGCCGGGCACAGG - Intronic
1161981984 19:7634716-7634738 AACACCTTCATTTCAGGCTGTGG - Intronic
1165120405 19:33555290-33555312 TGCCAGGTCATTTCAGGGAGAGG - Intergenic
1165315934 19:35055498-35055520 AGCCCCATCTTTTCAGGCTCAGG + Intronic
1166220329 19:41360145-41360167 AGCACCGTGATTCCAGACAGTGG - Intronic
1166247206 19:41537687-41537709 ACCCCCCTCATCCCAGGCAGTGG - Intergenic
925768941 2:7263812-7263834 AGCGCCGTCATTGAATGCAGCGG + Intergenic
928128424 2:28631723-28631745 AGACCCAGCCTTTCAGGCAGAGG + Intronic
933421958 2:82059737-82059759 AGTCCTGGGATTTCAGGCAGAGG + Intergenic
936620367 2:114090101-114090123 AGCCATCCCATTTCAGGCAGTGG - Intergenic
940007199 2:149018754-149018776 AGCCCAGTAATTTGAGGCTGTGG + Intronic
945472163 2:210239586-210239608 ATCTCTCTCATTTCAGGCAGAGG - Intergenic
1172613185 20:36266694-36266716 CACCCCTTCTTTTCAGGCAGTGG + Intronic
1173956757 20:47039060-47039082 AGCCCAGCCATTTCAGGGACAGG - Intronic
1175228730 20:57460436-57460458 ACAGCCGTCATTTCAGACAGAGG + Intergenic
1175397646 20:58677922-58677944 GGCCCTGGCATTTCAGGAAGCGG + Exonic
1175534357 20:59697418-59697440 ATCCCCATCCTTGCAGGCAGAGG + Intronic
1179462235 21:41544309-41544331 AGCCCCAGCATTTGAGGCTGAGG + Intergenic
1181771240 22:25127318-25127340 GGTTCCGTCATTCCAGGCAGAGG - Intronic
1182627086 22:31655391-31655413 AGCCCAGAAATTTGAGGCAGCGG - Intronic
1183115708 22:35691124-35691146 AGCCCAGTAATTTGAGGCTGCGG + Intergenic
952831645 3:37570123-37570145 AGCCCCGGCATTTCTGCCCGGGG + Intronic
954711542 3:52507469-52507491 AGCACTGGCATTCCAGGCAGAGG - Intronic
962936202 3:140082957-140082979 AGCACCATCATTTCAACCAGAGG + Intronic
963193932 3:142505160-142505182 AGCCCTGTCATAACAAGCAGTGG + Exonic
963392673 3:144687963-144687985 AGGCCAGTCTTTTCAGGCATTGG + Intergenic
963525556 3:146410528-146410550 AGTCCTGTCATTTCTGCCAGAGG - Intronic
964194327 3:154045186-154045208 TTCCCCCTCATATCAGGCAGAGG - Intergenic
965165746 3:165193440-165193462 ATCCCCGTCATTGCAGGGAATGG - Intronic
965610233 3:170535783-170535805 CCCCCTGTCATTTCAGGCAGTGG + Intronic
969357659 4:6639959-6639981 AGCCCCTTCCTTTCACGCAGGGG - Intergenic
970344893 4:15143864-15143886 AACCCCCTCATTTCAGAGAGTGG - Intergenic
978564917 4:110071544-110071566 ATCACCTTCTTTTCAGGCAGGGG + Intronic
983394303 4:167173943-167173965 AGACCAGACATTCCAGGCAGAGG + Intronic
997396826 5:133567546-133567568 AGCACCTACAGTTCAGGCAGAGG - Intronic
998001070 5:138626398-138626420 AGACACGTCATTTAGGGCAGTGG - Intronic
998896668 5:146807356-146807378 AGACCAGTCAGTTCTGGCAGAGG + Intronic
999715754 5:154358653-154358675 AGCACCGTCATTACTGGCAGTGG - Intronic
1002457075 5:179351290-179351312 TGCTCCGTCATGTCAGGGAGGGG - Intergenic
1006338667 6:33433749-33433771 AGCCCCGTCATCGCAGGCTCTGG - Intronic
1010606543 6:77896085-77896107 AGCCCCATAATTTAAGACAGTGG + Intronic
1011696498 6:89917991-89918013 AGCGCTGCCATTGCAGGCAGTGG + Intergenic
1018996853 6:168716767-168716789 AGCCCAGTGTTTTTAGGCAGAGG + Intergenic
1019192316 6:170259441-170259463 ACCCCAGTGAGTTCAGGCAGAGG + Intergenic
1019918260 7:4147256-4147278 AGCCCAGGCATTCCAGGCTGCGG - Intronic
1021790102 7:24196123-24196145 AGCCCAGTCAGTCCAGGCAGAGG + Intergenic
1024202694 7:47122596-47122618 AGCCCCTTCAGGTGAGGCAGAGG - Intergenic
1035384153 7:158459251-158459273 AGCCCATTCATCCCAGGCAGTGG - Intronic
1035384164 7:158459290-158459312 AGCCCATTCATCCCAGGCAGTGG - Intronic
1035468490 7:159095031-159095053 AGCCCTCTCATTTCACGAAGTGG - Intronic
1044984648 8:97746916-97746938 AGCCCAGTCTTTTCAGGTAGGGG - Intergenic
1046969191 8:120202467-120202489 ATCCCCGTCATTTCAATCATCGG - Intronic
1049346799 8:142143574-142143596 AGCCCCACCGTCTCAGGCAGGGG + Intergenic
1055764061 9:79642331-79642353 AGCCCAGGCATTTGAGGCTGTGG - Intronic
1057779038 9:98034954-98034976 AGCTCTGTCCTTTCACGCAGAGG - Intergenic
1062181927 9:135195529-135195551 TGCCCAGTCATTCAAGGCAGAGG - Intergenic
1201313715 Y:12621806-12621828 AGCTCCGTTACCTCAGGCAGTGG - Intergenic